EMAIL THIS PAGE TO A FRIEND

USP53

ubiquitin specific peptidase 53

UniProtKB ID: Q70EK8, Q68DA5, Q8WVQ5, Q9P2J7
Gene ID:
Mouse(99526) ubiquitin specific peptidase 53
Rat(295425) ubiquitin specific peptidase 53
chicken(422680) ubiquitin specific peptidase 53
Horse(100072411) ubiquitin specific peptidase 53
domestic cat(101095738) ubiquitin specific peptidase 53
dog(487923) ubiquitin specific peptidase 53
cow(529462) ubiquitin specific peptidase 53
sheep(101110058) ubiquitin specific peptidase 53
domestic guinea pig(100719539) ubiquitin specific peptidase 53
naked mole-rat(101723513) ubiquitin specific peptidase 53
129 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_052597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_052597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_052597 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133857 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133857 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133857 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019050 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019050 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019050 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019050 Rosetta Predictions human pricing
NM_001106468 Rosetta Predictions rat pricing
NM_133857 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234222 predicted 3964
2 SASI_Hs01_00234224 predicted 2348
3 SASI_Hs02_00352619 predicted 3332
4 SASI_Hs01_00234225 predicted 3272
5 SASI_Hs02_00352620 predicted 1390
6 SASI_Hs01_00234226 predicted 1693
7 SASI_Hs01_00234227 predicted 2752
8 SASI_Hs01_00234228 predicted 3899
9 SASI_Hs01_00234229 predicted 3176
10 SASI_Hs01_00234230 predicted 2772
11 SASI_Hs01_00234221 predicted 530
12 SASI_Hs01_00234223 predicted 1756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106468 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219258 predicted 1842
2 SASI_Rn02_00219259 predicted 2518
3 SASI_Rn02_00219260 predicted 3705
4 SASI_Rn02_00219261 predicted 3751
5 SASI_Rn02_00219262 predicted 2380
6 SASI_Rn02_00219263 predicted 2669
7 SASI_Rn02_00219264 predicted 3515
8 SASI_Rn02_00219265 predicted 2417
9 SASI_Rn02_00219266 predicted 3264
10 SASI_Rn02_00219267 predicted 3047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338917 predicted 712
2 SASI_Mm01_00119045 predicted 3487
3 SASI_Mm01_00119046 predicted 3744
4 SASI_Mm01_00119048 predicted 1098
5 SASI_Mm02_00338918 predicted 2378
6 SASI_Mm01_00119049 predicted 2586
7 SASI_Mm01_00119050 predicted 3331
8 SASI_Mm01_00119051 predicted 3775
9 SASI_Mm01_00119052 predicted 2753
10 SASI_Mm01_00119053 predicted 3773
11 SASI_Mm01_00119047 predicted 2054
12 SASI_Mm01_00119054 predicted 2739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_052597
USP53 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 53
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_052597.7-2772s1c1
Sequence:CCGGGCCACCAAAGAAATATGCTATCTCGAGATAGCATATTTCTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_052597.7-1685s1c1
Sequence:CCGGGCAGCCAAGATTCTAGGGATACTCGAGTATCCCTAGAATCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_052597.7-58s1c1
Sequence:CCGGCCTGGAAGTATGCTATCACTACTCGAGTAGTGATAGCATACTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_052597.7-1147s1c1
Sequence:CCGGCCTGTAATTCATAAGTCAGATCTCGAGATCTGACTTATGAATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_052597.7-3080s1c1
Sequence:CCGGCCTGTCCAAATGAGACAGTTTCTCGAGAAACTGTCTCATTTGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_052597
USP53 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 53
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_052597.7-2772s1c1
Sequence:CCGGGCCACCAAAGAAATATGCTATCTCGAGATAGCATATTTCTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_052597.7-1685s1c1
Sequence:CCGGGCAGCCAAGATTCTAGGGATACTCGAGTATCCCTAGAATCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_052597.7-58s1c1
Sequence:CCGGCCTGGAAGTATGCTATCACTACTCGAGTAGTGATAGCATACTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_052597.7-1147s1c1
Sequence:CCGGCCTGTAATTCATAAGTCAGATCTCGAGATCTGACTTATGAATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_052597.7-3080s1c1
Sequence:CCGGCCTGTCCAAATGAGACAGTTTCTCGAGAAACTGTCTCATTTGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_052597
USP53 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 53
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_052597.7-2772s1c1
Sequence:CCGGGCCACCAAAGAAATATGCTATCTCGAGATAGCATATTTCTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_052597.7-1685s1c1
Sequence:CCGGGCAGCCAAGATTCTAGGGATACTCGAGTATCCCTAGAATCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_052597.7-58s1c1
Sequence:CCGGCCTGGAAGTATGCTATCACTACTCGAGTAGTGATAGCATACTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_052597.7-1147s1c1
Sequence:CCGGCCTGTAATTCATAAGTCAGATCTCGAGATCTGACTTATGAATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_052597.7-3080s1c1
Sequence:CCGGCCTGTCCAAATGAGACAGTTTCTCGAGAAACTGTCTCATTTGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133857
VALIDATED
USP53 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 53
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133857.1-3611s1c1
Sequence:CCGGCCCAGGAAAGAGATAAAGAAACTCGAGTTTCTTTATCTCTTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133857.1-3666s1c1
Sequence:CCGGCCCGTCCAGTTGTTCAACTAACTCGAGTTAGTTGAACAACTGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133857.1-1922s1c1
Sequence:CCGGCCTCACTTAATCGGAGCCAAACTCGAGTTTGGCTCCGATTAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133857.1-964s1c1
Sequence:CCGGCCCTCAGATAACATAAGGCATCTCGAGATGCCTTATGTTATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133857.1-1247s1c1
Sequence:CCGGCCCTGTGCAATGAAGTTGAAACTCGAGTTTCAACTTCATTGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133857.3-3665s21c1
Sequence:CCGGCCCGTCCAGTTGTTCAACTAACTCGAGTTAGTTGAACAACTGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133857.3-1216s21c1
Sequence:CCGGCCGAACTCGTGAGGTACATTTCTCGAGAAATGTACCTCACGAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133857.3-2855s21c1
Sequence:CCGGTAAGATGAACAGCCATAATATCTCGAGATATTATGGCTGTTCATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133857.3-3610s21c1
Sequence:CCGGCCCAGGAAAGAGATAAAGAAACTCGAGTTTCTTTATCTCTTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133857.3-1246s21c1
Sequence:CCGGCCCTGTGCAATGAAGTTGAAACTCGAGTTTCAACTTCATTGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133857
VALIDATED
USP53 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 53
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133857.1-3611s1c1
Sequence:CCGGCCCAGGAAAGAGATAAAGAAACTCGAGTTTCTTTATCTCTTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133857.1-3666s1c1
Sequence:CCGGCCCGTCCAGTTGTTCAACTAACTCGAGTTAGTTGAACAACTGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133857.1-1922s1c1
Sequence:CCGGCCTCACTTAATCGGAGCCAAACTCGAGTTTGGCTCCGATTAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133857.1-964s1c1
Sequence:CCGGCCCTCAGATAACATAAGGCATCTCGAGATGCCTTATGTTATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133857.1-1247s1c1
Sequence:CCGGCCCTGTGCAATGAAGTTGAAACTCGAGTTTCAACTTCATTGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133857.3-3665s21c1
Sequence:CCGGCCCGTCCAGTTGTTCAACTAACTCGAGTTAGTTGAACAACTGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133857.3-1216s21c1
Sequence:CCGGCCGAACTCGTGAGGTACATTTCTCGAGAAATGTACCTCACGAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133857.3-2855s21c1
Sequence:CCGGTAAGATGAACAGCCATAATATCTCGAGATATTATGGCTGTTCATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133857.3-3610s21c1
Sequence:CCGGCCCAGGAAAGAGATAAAGAAACTCGAGTTTCTTTATCTCTTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133857.3-1246s21c1
Sequence:CCGGCCCTGTGCAATGAAGTTGAAACTCGAGTTTCAACTTCATTGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133857
VALIDATED
USP53 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 53
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133857.1-3611s1c1
Sequence:CCGGCCCAGGAAAGAGATAAAGAAACTCGAGTTTCTTTATCTCTTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133857.1-3666s1c1
Sequence:CCGGCCCGTCCAGTTGTTCAACTAACTCGAGTTAGTTGAACAACTGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133857.1-1922s1c1
Sequence:CCGGCCTCACTTAATCGGAGCCAAACTCGAGTTTGGCTCCGATTAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133857.1-964s1c1
Sequence:CCGGCCCTCAGATAACATAAGGCATCTCGAGATGCCTTATGTTATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133857.1-1247s1c1
Sequence:CCGGCCCTGTGCAATGAAGTTGAAACTCGAGTTTCAACTTCATTGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133857.3-3665s21c1
Sequence:CCGGCCCGTCCAGTTGTTCAACTAACTCGAGTTAGTTGAACAACTGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133857.3-1216s21c1
Sequence:CCGGCCGAACTCGTGAGGTACATTTCTCGAGAAATGTACCTCACGAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133857.3-2855s21c1
Sequence:CCGGTAAGATGAACAGCCATAATATCTCGAGATATTATGGCTGTTCATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133857.3-3610s21c1
Sequence:CCGGCCCAGGAAAGAGATAAAGAAACTCGAGTTTCTTTATCTCTTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133857.3-1246s21c1
Sequence:CCGGCCCTGTGCAATGAAGTTGAAACTCGAGTTTCAACTTCATTGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019050
VALIDATED
USP53 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 53
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019050.2-1291s21c1
Sequence:CCGGTTGTGCATTGAAGACGATATTCTCGAGAATATCGTCTTCAATGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019050.2-1341s21c1
Sequence:CCGGCACTTCCCTCAGATAACATAACTCGAGTTATGTTATCTGAGGGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019050.2-3148s21c1
Sequence:CCGGCAGTAATGGTTCTACTAATTTCTCGAGAAATTAGTAGAACCATTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019050.2-2213s21c1
Sequence:CCGGCCTGTAATTCATAAGTCAGATCTCGAGATCTGACTTATGAATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019050.2-4721s21c1
Sequence:CCGGACTCATGTATGGAGATTATAACTCGAGTTATAATCTCCATACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019050
VALIDATED
USP53 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 53
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019050.2-1291s21c1
Sequence:CCGGTTGTGCATTGAAGACGATATTCTCGAGAATATCGTCTTCAATGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019050.2-1341s21c1
Sequence:CCGGCACTTCCCTCAGATAACATAACTCGAGTTATGTTATCTGAGGGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019050.2-3148s21c1
Sequence:CCGGCAGTAATGGTTCTACTAATTTCTCGAGAAATTAGTAGAACCATTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019050.2-2213s21c1
Sequence:CCGGCCTGTAATTCATAAGTCAGATCTCGAGATCTGACTTATGAATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019050.2-4721s21c1
Sequence:CCGGACTCATGTATGGAGATTATAACTCGAGTTATAATCTCCATACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019050
VALIDATED
USP53 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 53
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019050.2-1291s21c1
Sequence:CCGGTTGTGCATTGAAGACGATATTCTCGAGAATATCGTCTTCAATGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019050.2-1341s21c1
Sequence:CCGGCACTTCCCTCAGATAACATAACTCGAGTTATGTTATCTGAGGGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019050.2-3148s21c1
Sequence:CCGGCAGTAATGGTTCTACTAATTTCTCGAGAAATTAGTAGAACCATTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019050.2-2213s21c1
Sequence:CCGGCCTGTAATTCATAAGTCAGATCTCGAGATCTGACTTATGAATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019050.2-4721s21c1
Sequence:CCGGACTCATGTATGGAGATTATAACTCGAGTTATAATCTCCATACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks