EMAIL THIS PAGE TO A FRIEND

USP54

ubiquitin specific peptidase 54

Synonyms: C10orf29 bA137L10.3 bA137L10.4
Gene ID:
Mouse(78787) ubiquitin specific peptidase 54
Rat(408223) ubiquitin specific peptidase 54
naked mole-rat(101708994) ubiquitin specific peptidase 54
Domestic Rabbit(100359321) ubiquitin specific peptidase 54
domestic guinea pig(100719435) ubiquitin specific peptidase 54
cow(100296008) ubiquitin specific peptidase 54
cow(100336042) ubiquitin specific peptidase 54-like
sheep(101119364) ubiquitin specific peptidase 54
chicken(423746) ubiquitin specific peptidase 54
Horse(100063948) ubiquitin specific peptidase 54
domestic cat(101087174) ubiquitin specific peptidase 54
dog(479249) ubiquitin specific peptidase 54
143 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA047663 Anti-USP54 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152586 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152586 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152586 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030180 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030180 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030180 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152586 Rosetta Predictions human pricing
NM_001008863 Rosetta Predictions rat pricing
NM_030180 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366408 predicted 782
2 SASI_Hs02_00366409 predicted 2706
3 SASI_Hs02_00366410 predicted 211
4 SASI_Hs01_00182343 predicted 4680
5 SASI_Hs02_00366411 predicted 2301
6 SASI_Hs02_00366412 predicted 1553
7 SASI_Hs01_00182346 predicted 3462
8 SASI_Hs02_00366413 predicted 265
9 SASI_Hs01_00182347 predicted 2911
10 SASI_Hs02_00366414 predicted 1365
11 SASI_Hs01_00182342 predicted 3170
12 SASI_Hs01_00182344 predicted 2848
13 SASI_Hs01_00182345 predicted 2342
14 SASI_Hs01_00182348 predicted 3904
15 SASI_Hs01_00182349 predicted 3609
16 SASI_Hs01_00182350 predicted 3860
17 SASI_Hs01_00182351 predicted 3940
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199382 predicted 2173
2 SASI_Rn02_00199383 predicted 2731
3 SASI_Rn02_00199384 predicted 2837
4 SASI_Rn02_00199385 predicted 4501
5 SASI_Rn01_00081033 predicted 1423
6 SASI_Rn02_00199386 predicted 4588
7 SASI_Rn02_00199387 predicted 2912
8 SASI_Rn02_00199388 predicted 3885
9 SASI_Rn01_00081035 predicted 1225
10 SASI_Rn02_00199389 predicted 2281
11 SASI_Rn01_00081032 predicted 993
12 SASI_Rn01_00081034 predicted 408
13 SASI_Rn01_00081036 predicted 389
14 SASI_Rn01_00081037 predicted 736
15 SASI_Rn01_00081038 predicted 869
16 SASI_Rn01_00081039 predicted 250
17 SASI_Rn01_00081040 predicted 282
18 SASI_Rn01_00081041 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336593 predicted 926
2 SASI_Mm02_00336594 predicted 3638
3 SASI_Mm02_00336595 predicted 3031
4 SASI_Mm02_00336596 predicted 981
5 SASI_Mm02_00336597 predicted 1122
6 SASI_Mm02_00336598 predicted 1300
7 SASI_Mm02_00336599 predicted 1545
8 SASI_Mm01_00113707 predicted 4352
9 SASI_Mm02_00336600 predicted 4081
10 SASI_Mm02_00336601 predicted 3247
11 SASI_Mm01_00113700 predicted 558
12 SASI_Mm01_00113701 predicted 1019
13 SASI_Mm01_00113702 predicted 1217
14 SASI_Mm01_00113703 predicted 217
15 SASI_Mm01_00113704 predicted 1311
16 SASI_Mm01_00113705 predicted 984
17 SASI_Mm01_00113706 predicted 500
18 SASI_Mm01_00113708 predicted 582
19 SASI_Mm01_00113709 predicted 901
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152586
USP54 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 54
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152586.3-1877s21c1
Sequence:CCGGGCCACCTTCTTACGACATTAACTCGAGTTAATGTCGTAAGAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152586.3-549s21c1
Sequence:CCGGTTCATCCAGATGGTACATTATCTCGAGATAATGTACCATCTGGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152586.3-5520s21c1
Sequence:CCGGAGGGTGTCAGGAACCTCTAAACTCGAGTTTAGAGGTTCCTGACACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152586.2-3203s1c1
Sequence:CCGGGTTCTGTGATTCTCAGCTTAACTCGAGTTAAGCTGAGAATCACAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152586.2-2560s1c1
Sequence:CCGGGCTGTAGTCCTTCAAATTCATCTCGAGATGAATTTGAAGGACTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152586.2-2306s1c1
Sequence:CCGGCCACAGGCAAGGTTTACCTAACTCGAGTTAGGTAAACCTTGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152586.2-2828s1c1
Sequence:CCGGCATGAGGGATAGTACAGGTTTCTCGAGAAACCTGTACTATCCCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152586.2-4031s1c1
Sequence:CCGGCCAGCATATTGGGACCAGATTCTCGAGAATCTGGTCCCAATATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152586
USP54 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 54
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152586.3-1877s21c1
Sequence:CCGGGCCACCTTCTTACGACATTAACTCGAGTTAATGTCGTAAGAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152586.3-549s21c1
Sequence:CCGGTTCATCCAGATGGTACATTATCTCGAGATAATGTACCATCTGGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152586.3-5520s21c1
Sequence:CCGGAGGGTGTCAGGAACCTCTAAACTCGAGTTTAGAGGTTCCTGACACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152586.2-3203s1c1
Sequence:CCGGGTTCTGTGATTCTCAGCTTAACTCGAGTTAAGCTGAGAATCACAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152586.2-2560s1c1
Sequence:CCGGGCTGTAGTCCTTCAAATTCATCTCGAGATGAATTTGAAGGACTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152586.2-2306s1c1
Sequence:CCGGCCACAGGCAAGGTTTACCTAACTCGAGTTAGGTAAACCTTGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152586.2-2828s1c1
Sequence:CCGGCATGAGGGATAGTACAGGTTTCTCGAGAAACCTGTACTATCCCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152586.2-4031s1c1
Sequence:CCGGCCAGCATATTGGGACCAGATTCTCGAGAATCTGGTCCCAATATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152586
USP54 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 54
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152586.3-1877s21c1
Sequence:CCGGGCCACCTTCTTACGACATTAACTCGAGTTAATGTCGTAAGAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152586.3-549s21c1
Sequence:CCGGTTCATCCAGATGGTACATTATCTCGAGATAATGTACCATCTGGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152586.3-5520s21c1
Sequence:CCGGAGGGTGTCAGGAACCTCTAAACTCGAGTTTAGAGGTTCCTGACACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152586.2-3203s1c1
Sequence:CCGGGTTCTGTGATTCTCAGCTTAACTCGAGTTAAGCTGAGAATCACAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152586.2-2560s1c1
Sequence:CCGGGCTGTAGTCCTTCAAATTCATCTCGAGATGAATTTGAAGGACTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152586.2-2306s1c1
Sequence:CCGGCCACAGGCAAGGTTTACCTAACTCGAGTTAGGTAAACCTTGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152586.2-2828s1c1
Sequence:CCGGCATGAGGGATAGTACAGGTTTCTCGAGAAACCTGTACTATCCCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152586.2-4031s1c1
Sequence:CCGGCCAGCATATTGGGACCAGATTCTCGAGAATCTGGTCCCAATATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030180
VALIDATED
USP54 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 54
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030180.1-79s1c1
Sequence:CCGGCCAGACTTCATTGACTTCAAACTCGAGTTTGAAGTCAATGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030180.1-460s1c1
Sequence:CCGGGCCAGATATGTACCAAGGAAACTCGAGTTTCCTTGGTACATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030180.1-2287s1c1
Sequence:CCGGCCCAACTTACACTCTTTGTTTCTCGAGAAACAAAGAGTGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030180.1-1476s1c1
Sequence:CCGGCCCTTAGGTCAACTTGGAATTCTCGAGAATTCCAAGTTGACCTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030180.1-223s1c1
Sequence:CCGGCCAGGATAGAAGTTTGCCAAACTCGAGTTTGGCAAACTTCTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030180
VALIDATED
USP54 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 54
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030180.1-79s1c1
Sequence:CCGGCCAGACTTCATTGACTTCAAACTCGAGTTTGAAGTCAATGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030180.1-460s1c1
Sequence:CCGGGCCAGATATGTACCAAGGAAACTCGAGTTTCCTTGGTACATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030180.1-2287s1c1
Sequence:CCGGCCCAACTTACACTCTTTGTTTCTCGAGAAACAAAGAGTGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030180.1-1476s1c1
Sequence:CCGGCCCTTAGGTCAACTTGGAATTCTCGAGAATTCCAAGTTGACCTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030180.1-223s1c1
Sequence:CCGGCCAGGATAGAAGTTTGCCAAACTCGAGTTTGGCAAACTTCTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030180
VALIDATED
USP54 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 54
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030180.1-79s1c1
Sequence:CCGGCCAGACTTCATTGACTTCAAACTCGAGTTTGAAGTCAATGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030180.1-460s1c1
Sequence:CCGGGCCAGATATGTACCAAGGAAACTCGAGTTTCCTTGGTACATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030180.1-2287s1c1
Sequence:CCGGCCCAACTTACACTCTTTGTTTCTCGAGAAACAAAGAGTGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030180.1-1476s1c1
Sequence:CCGGCCCTTAGGTCAACTTGGAATTCTCGAGAATTCCAAGTTGACCTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030180.1-223s1c1
Sequence:CCGGCCAGGATAGAAGTTTGCCAAACTCGAGTTTGGCAAACTTCTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks