EMAIL THIS PAGE TO A FRIEND

USP5

ubiquitin specific peptidase 5 (isopeptidase T)

Synonyms: ISOT
UniProtKB ID: P45974, D3DUS7, D3DUS8, Q96J22
Gene ID:
Human(8078) Summary: Ubiquitin (see MIM 191339)-dependent proteolysis is a complex pathway of protein metabolism implicated in such diverse cellular functions as maintenance of chromatin structure, receptor function, and degradation of abnormal proteins. A late step of the process involves disassembly of the polyubiquitin chains on degraded proteins into ubiquitin monomers. USP5 disassembles branched polyubiquitin chains by a sequential exo mechanism, starting at the proximal end of the chain (Wilkinson et al., 1995 [PubMed 7578059]
Mouse(22225) ubiquitin specific peptidase 5 (isopeptidase T)
Rat(297593) ubiquitin specific peptidase 5 (isopeptidase T)
naked mole-rat(101720419) ubiquitin specific peptidase 5 (isopeptidase T)
domestic guinea pig(100724997) ubiquitin specific peptidase 5 (isopeptidase T)
cow(505280) ubiquitin specific peptidase 5 (isopeptidase T)
sheep(101109954) ubiquitin specific peptidase 5 (isopeptidase T)
Zebrafish(406618) ubiquitin specific protease 5
Horse(100060068) ubiquitin specific peptidase 5 (isopeptidase T)
domestic cat(101085296) ubiquitin specific peptidase 5 (isopeptidase T)
dog(486718) ubiquitin specific peptidase 5 (isopeptidase T)
chicken(418290) ubiquitin specific peptidase 5 (isopeptidase T)
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003481 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013700 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013700 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013700 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098536 Rosetta Predictions human pricing
NM_003481 Rosetta Predictions human pricing
NM_001106619 Rosetta Predictions rat pricing
NM_013700 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319396 predicted 787
2 SASI_Hs02_00319397 predicted 1424
3 SASI_Hs02_00319398 predicted 1046
4 SASI_Hs02_00319399 predicted 923
5 SASI_Hs02_00319400 predicted 1400
6 SASI_Hs02_00319401 predicted 1007
7 SASI_Hs02_00319402 predicted 1111
8 SASI_Hs02_00319403 predicted 1718
9 SASI_Hs02_00319404 predicted 367
10 SASI_Hs02_00319405 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184929 predicted 781
2 SASI_Hs01_00184930 predicted 1415
3 SASI_Hs02_00335743 predicted 1046
4 SASI_Hs01_00184932 predicted 910
5 SASI_Hs01_00184933 predicted 1398
6 SASI_Hs02_00335744 predicted 1004
7 SASI_Hs01_00184936 predicted 1107
8 SASI_Hs01_00184937 predicted 1719
9 SASI_Hs02_00335745 predicted 360
10 SASI_Hs02_00335746 predicted 1256
11 SASI_Hs01_00184931 predicted 925
12 SASI_Hs01_00184934 predicted 1998
13 SASI_Hs01_00184935 predicted 1782
14 SASI_Hs01_00184938 predicted 1739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220728 predicted 2525
2 SASI_Rn02_00220729 predicted 607
3 SASI_Rn02_00220730 predicted 1033
4 SASI_Rn02_00220731 predicted 682
5 SASI_Rn02_00220732 predicted 1522
6 SASI_Rn02_00220733 predicted 1419
7 SASI_Rn02_00220734 predicted 541
8 SASI_Rn02_00220735 predicted 1443
9 SASI_Rn02_00220736 predicted 2342
10 SASI_Rn02_00220737 predicted 2359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126709 predicted 2480
2 SASI_Mm01_00126710 predicted 2494
3 SASI_Mm01_00126711 predicted 1835
4 SASI_Mm01_00126712 predicted 363
5 SASI_Mm01_00126713 predicted 1394
6 SASI_Mm01_00126714 predicted 2078
7 SASI_Mm01_00126715 predicted 1978
8 SASI_Mm01_00126716 predicted 1200
9 SASI_Mm01_00126717 predicted 877
10 SASI_Mm02_00322597 predicted 1492
11 SASI_Mm01_00126718 predicted 1792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003481
VALIDATED
USP5 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 5 (isopeptidase T)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003481.2-2220s21c1
Sequence:CCGGCGGGCCACGAACAATAGTTTACTCGAGTAAACTATTGTTCGTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003481.2-2393s21c1
Sequence:CCGGCTTTGCCTTCATTAGTCACATCTCGAGATGTGACTAATGAAGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003481.2-2783s21c1
Sequence:CCGGCCTGTCTGTAAGGAGACTTTGCTCGAGCAAAGTCTCCTTACAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003481.2-406s21c1
Sequence:CCGGAGGATGTGAAGATTGTCATTTCTCGAGAAATGACAATCTTCACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003481.2-944s21c1
Sequence:CCGGGATAGACATGAACCAGCGGATCTCGAGATCCGCTGGTTCATGTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003481.x-2383s1c1
Sequence:CCGGCTTTGCCTTCATTAGTCACATCTCGAGATGTGACTAATGAAGGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003481.x-335s1c1
Sequence:CCGGCGGCTGGCTATTGGTGTTGAACTCGAGTTCAACACCAATAGCCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003481.x-1717s1c1
Sequence:CCGGGACCACACGATTTGCCTCATTCTCGAGAATGAGGCAAATCGTGTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003481.x-371s1c1
Sequence:CCGGAGCGAGGAGAAGTTTGAATTACTCGAGTAATTCAAACTTCTCCTCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003481.x-934s1c1
Sequence:CCGGGATAGACATGAACCAGCGGATCTCGAGATCCGCTGGTTCATGTCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003481
VALIDATED
USP5 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 5 (isopeptidase T)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003481.2-2220s21c1
Sequence:CCGGCGGGCCACGAACAATAGTTTACTCGAGTAAACTATTGTTCGTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003481.2-2393s21c1
Sequence:CCGGCTTTGCCTTCATTAGTCACATCTCGAGATGTGACTAATGAAGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003481.2-2783s21c1
Sequence:CCGGCCTGTCTGTAAGGAGACTTTGCTCGAGCAAAGTCTCCTTACAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003481.2-406s21c1
Sequence:CCGGAGGATGTGAAGATTGTCATTTCTCGAGAAATGACAATCTTCACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003481.2-944s21c1
Sequence:CCGGGATAGACATGAACCAGCGGATCTCGAGATCCGCTGGTTCATGTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003481.x-2383s1c1
Sequence:CCGGCTTTGCCTTCATTAGTCACATCTCGAGATGTGACTAATGAAGGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003481.x-335s1c1
Sequence:CCGGCGGCTGGCTATTGGTGTTGAACTCGAGTTCAACACCAATAGCCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003481.x-1717s1c1
Sequence:CCGGGACCACACGATTTGCCTCATTCTCGAGAATGAGGCAAATCGTGTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003481.x-371s1c1
Sequence:CCGGAGCGAGGAGAAGTTTGAATTACTCGAGTAATTCAAACTTCTCCTCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003481.x-934s1c1
Sequence:CCGGGATAGACATGAACCAGCGGATCTCGAGATCCGCTGGTTCATGTCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003481
VALIDATED
USP5 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 5 (isopeptidase T)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003481.2-2220s21c1
Sequence:CCGGCGGGCCACGAACAATAGTTTACTCGAGTAAACTATTGTTCGTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003481.2-2393s21c1
Sequence:CCGGCTTTGCCTTCATTAGTCACATCTCGAGATGTGACTAATGAAGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003481.2-2783s21c1
Sequence:CCGGCCTGTCTGTAAGGAGACTTTGCTCGAGCAAAGTCTCCTTACAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003481.2-406s21c1
Sequence:CCGGAGGATGTGAAGATTGTCATTTCTCGAGAAATGACAATCTTCACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003481.2-944s21c1
Sequence:CCGGGATAGACATGAACCAGCGGATCTCGAGATCCGCTGGTTCATGTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003481.x-2383s1c1
Sequence:CCGGCTTTGCCTTCATTAGTCACATCTCGAGATGTGACTAATGAAGGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003481.x-335s1c1
Sequence:CCGGCGGCTGGCTATTGGTGTTGAACTCGAGTTCAACACCAATAGCCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003481.x-1717s1c1
Sequence:CCGGGACCACACGATTTGCCTCATTCTCGAGAATGAGGCAAATCGTGTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003481.x-371s1c1
Sequence:CCGGAGCGAGGAGAAGTTTGAATTACTCGAGTAATTCAAACTTCTCCTCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003481.x-934s1c1
Sequence:CCGGGATAGACATGAACCAGCGGATCTCGAGATCCGCTGGTTCATGTCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013700
VALIDATED
USP5 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 5 (isopeptidase T)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013700.1-2016s21c1
Sequence:CCGGTGGACGAATCCGTCATCATACCTCGAGGTATGATGACGGATTCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013700.1-2590s21c1
Sequence:CCGGCCTGGGCTACATCTACTTCTACTCGAGTAGAAGTAGATGTAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013700.1-403s21c1
Sequence:CCGGCGAGGATGTGAAGATTGTCATCTCGAGATGACAATCTTCACATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013700.1-2071s21c1
Sequence:CCGGCCGGAAAGCTGTGTACTATACCTCGAGGTATAGTACACAGCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013700.1-2967s21c1
Sequence:CCGGATGTGGCTTTATGCATCTTTCCTCGAGGAAAGATGCATAAAGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013700.1-3017s1c1
Sequence:CCGGCCCTTAAGTGTTTGCTCCCTTCTCGAGAAGGGAGCAAACACTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013700.1-1539s1c1
Sequence:CCGGCCCTTAACAAAGAGGAGCTTTCTCGAGAAAGCTCCTCTTTGTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013700.1-1295s1c1
Sequence:CCGGCGAATGTTCAAGGCCCTCATTCTCGAGAATGAGGGCCTTGAACATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013700.1-2590s1c1
Sequence:CCGGCCTGGGCTACATCTACTTCTACTCGAGTAGAAGTAGATGTAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013700.1-403s1c1
Sequence:CCGGCGAGGATGTGAAGATTGTCATCTCGAGATGACAATCTTCACATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013700
VALIDATED
USP5 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 5 (isopeptidase T)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013700.1-2016s21c1
Sequence:CCGGTGGACGAATCCGTCATCATACCTCGAGGTATGATGACGGATTCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013700.1-2590s21c1
Sequence:CCGGCCTGGGCTACATCTACTTCTACTCGAGTAGAAGTAGATGTAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013700.1-403s21c1
Sequence:CCGGCGAGGATGTGAAGATTGTCATCTCGAGATGACAATCTTCACATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013700.1-2071s21c1
Sequence:CCGGCCGGAAAGCTGTGTACTATACCTCGAGGTATAGTACACAGCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013700.1-2967s21c1
Sequence:CCGGATGTGGCTTTATGCATCTTTCCTCGAGGAAAGATGCATAAAGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013700.1-3017s1c1
Sequence:CCGGCCCTTAAGTGTTTGCTCCCTTCTCGAGAAGGGAGCAAACACTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013700.1-1539s1c1
Sequence:CCGGCCCTTAACAAAGAGGAGCTTTCTCGAGAAAGCTCCTCTTTGTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013700.1-1295s1c1
Sequence:CCGGCGAATGTTCAAGGCCCTCATTCTCGAGAATGAGGGCCTTGAACATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013700.1-2590s1c1
Sequence:CCGGCCTGGGCTACATCTACTTCTACTCGAGTAGAAGTAGATGTAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013700.1-403s1c1
Sequence:CCGGCGAGGATGTGAAGATTGTCATCTCGAGATGACAATCTTCACATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013700
VALIDATED
USP5 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 5 (isopeptidase T)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013700.1-2016s21c1
Sequence:CCGGTGGACGAATCCGTCATCATACCTCGAGGTATGATGACGGATTCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013700.1-2590s21c1
Sequence:CCGGCCTGGGCTACATCTACTTCTACTCGAGTAGAAGTAGATGTAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013700.1-403s21c1
Sequence:CCGGCGAGGATGTGAAGATTGTCATCTCGAGATGACAATCTTCACATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013700.1-2071s21c1
Sequence:CCGGCCGGAAAGCTGTGTACTATACCTCGAGGTATAGTACACAGCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013700.1-2967s21c1
Sequence:CCGGATGTGGCTTTATGCATCTTTCCTCGAGGAAAGATGCATAAAGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013700.1-3017s1c1
Sequence:CCGGCCCTTAAGTGTTTGCTCCCTTCTCGAGAAGGGAGCAAACACTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013700.1-1539s1c1
Sequence:CCGGCCCTTAACAAAGAGGAGCTTTCTCGAGAAAGCTCCTCTTTGTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013700.1-1295s1c1
Sequence:CCGGCGAATGTTCAAGGCCCTCATTCTCGAGAATGAGGGCCTTGAACATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013700.1-2590s1c1
Sequence:CCGGCCTGGGCTACATCTACTTCTACTCGAGTAGAAGTAGATGTAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013700.1-403s1c1
Sequence:CCGGCGAGGATGTGAAGATTGTCATCTCGAGATGACAATCTTCACATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks