EMAIL THIS PAGE TO A FRIEND

USP6

ubiquitin specific peptidase 6 (Tre-2 oncogene)

Synonyms: HRP1 TRE17 TRE2 Tre-2 USP6-short
Species: Human USP6(9098)
UniProtKB ID: P35125, Q15634, Q86WP6, Q8IWT4
Gene ID:
148 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004505 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004505 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004505 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039674 Rosetta Predictions human pricing
NM_004505 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167628 predicted 2585
2 SASI_Hs01_00167629 predicted 1940
3 SASI_Hs01_00167630 predicted 4529
4 SASI_Hs01_00167631 predicted 1701
5 SASI_Hs01_00167632 predicted 4461
6 SASI_Hs01_00167633 predicted 4531
7 SASI_Hs01_00167634 predicted 2561
8 SASI_Hs01_00167635 predicted 2612
9 SASI_Hs01_00167636 predicted 4115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337765 predicted 2572
2 SASI_Hs02_00337766 predicted 1935
3 SASI_Hs02_00337767 predicted 4520
4 SASI_Hs02_00337768 predicted 1701
5 SASI_Hs02_00337769 predicted 4457
6 SASI_Hs02_00337770 predicted 4522
7 SASI_Hs02_00337771 predicted 2549
8 SASI_Hs02_00337772 predicted 2599
9 SASI_Hs02_00337773 predicted 4100
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004505
VALIDATED
USP6 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 6 (Tre-2 oncogene)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004505.1-2032s1c1
Sequence:CCGGCCTCCTGAACATTCAGGAAATCTCGAGATTTCCTGAATGTTCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004505.1-2664s1c1
Sequence:CCGGTGCGGAACCAATTCTTCGATACTCGAGTATCGAAGAATTGGTTCCGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004505.1-7146s1c1
Sequence:CCGGCCCTGCAAGTTGATTCTCATTCTCGAGAATGAGAATCAACTTGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004505.1-1738s1c1
Sequence:CCGGGCGGAAGGACATACTTATGAACTCGAGTTCATAAGTATGTCCTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004505.1-1810s1c1
Sequence:CCGGCGTTGGAATCAACAGCAGCATCTCGAGATGCTGCTGTTGATTCCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004505.2-1738s21c1
Sequence:CCGGGGAGCGGAAGGACATACTTATCTCGAGATAAGTATGTCCTTCCGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004505.2-4513s21c1
Sequence:CCGGTCATGCCCAGGATCGTGATAACTCGAGTTATCACGATCCTGGGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004505.2-4109s21c1
Sequence:GTACCGGGCTTCTAGTCCAACACAAATACTCGAGTATTTGTGTTGGACTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004505.2-7556s21c1
Sequence:CCGGACCTGGACATGTCCCATTAAACTCGAGTTTAATGGGACATGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004505.2-1942s21c1
Sequence:CCGGGGGAGAATGGGAGACATATAACTCGAGTTATATGTCTCCCATTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004505
VALIDATED
USP6 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 6 (Tre-2 oncogene)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004505.1-2032s1c1
Sequence:CCGGCCTCCTGAACATTCAGGAAATCTCGAGATTTCCTGAATGTTCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004505.1-2664s1c1
Sequence:CCGGTGCGGAACCAATTCTTCGATACTCGAGTATCGAAGAATTGGTTCCGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004505.1-7146s1c1
Sequence:CCGGCCCTGCAAGTTGATTCTCATTCTCGAGAATGAGAATCAACTTGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004505.1-1738s1c1
Sequence:CCGGGCGGAAGGACATACTTATGAACTCGAGTTCATAAGTATGTCCTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004505.1-1810s1c1
Sequence:CCGGCGTTGGAATCAACAGCAGCATCTCGAGATGCTGCTGTTGATTCCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004505.2-1738s21c1
Sequence:CCGGGGAGCGGAAGGACATACTTATCTCGAGATAAGTATGTCCTTCCGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004505.2-4513s21c1
Sequence:CCGGTCATGCCCAGGATCGTGATAACTCGAGTTATCACGATCCTGGGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004505.2-4109s21c1
Sequence:GTACCGGGCTTCTAGTCCAACACAAATACTCGAGTATTTGTGTTGGACTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004505.2-7556s21c1
Sequence:CCGGACCTGGACATGTCCCATTAAACTCGAGTTTAATGGGACATGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004505.2-1942s21c1
Sequence:CCGGGGGAGAATGGGAGACATATAACTCGAGTTATATGTCTCCCATTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004505
VALIDATED
USP6 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 6 (Tre-2 oncogene)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004505.1-2032s1c1
Sequence:CCGGCCTCCTGAACATTCAGGAAATCTCGAGATTTCCTGAATGTTCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004505.1-2664s1c1
Sequence:CCGGTGCGGAACCAATTCTTCGATACTCGAGTATCGAAGAATTGGTTCCGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004505.1-7146s1c1
Sequence:CCGGCCCTGCAAGTTGATTCTCATTCTCGAGAATGAGAATCAACTTGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004505.1-1738s1c1
Sequence:CCGGGCGGAAGGACATACTTATGAACTCGAGTTCATAAGTATGTCCTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004505.1-1810s1c1
Sequence:CCGGCGTTGGAATCAACAGCAGCATCTCGAGATGCTGCTGTTGATTCCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004505.2-1738s21c1
Sequence:CCGGGGAGCGGAAGGACATACTTATCTCGAGATAAGTATGTCCTTCCGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004505.2-4513s21c1
Sequence:CCGGTCATGCCCAGGATCGTGATAACTCGAGTTATCACGATCCTGGGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004505.2-4109s21c1
Sequence:GTACCGGGCTTCTAGTCCAACACAAATACTCGAGTATTTGTGTTGGACTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004505.2-7556s21c1
Sequence:CCGGACCTGGACATGTCCCATTAAACTCGAGTTTAATGGGACATGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004505.2-1942s21c1
Sequence:CCGGGGGAGAATGGGAGACATATAACTCGAGTTATATGTCTCCCATTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks