EMAIL THIS PAGE TO A FRIEND

USP6NL

USP6 N-terminal like

Synonyms: RNTRE TRE2NL USP6NL-IT1
UniProtKB ID: Q92738, A8KA79, Q15400, Q5VV10, Q7L0K9
Gene ID:
Mouse(98910) USP6 N-terminal like
Rat(291309) USP6 N-terminal like
Zebrafish(561983) USP6 N-terminal like
Horse(100056928) USP6 N-terminal like
domestic cat(101084371) USP6 N-terminal like
dog(487132) USP6 N-terminal like
chicken(419104) USP6 N-terminal like
chicken(423110) USP6 N-terminal like
cow(530462) USP6 N-terminal like
sheep(101108151) USP6 N-terminal like
domestic guinea pig(100724115) USP6 N-terminal like
naked mole-rat(101704588) USP6 N-terminal like
161 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080491 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080491 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080491 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080491 Rosetta Predictions human pricing
XM_374768 Rosetta Predictions human pricing
XM_927409 Rosetta Predictions human pricing
XM_932055 Rosetta Predictions human pricing
NM_001106120 Rosetta Predictions rat pricing
NM_001080548 Rosetta Predictions mouse pricing
NM_181399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315355 predicted 578
2 SASI_Hs02_00315356 predicted 2440
3 SASI_Hs02_00315357 predicted 2623
4 SASI_Hs02_00315358 predicted 536
5 SASI_Hs02_00315359 predicted 512
6 SASI_Hs02_00315360 predicted 2006
7 SASI_Hs02_00315361 predicted 2579
8 SASI_Hs02_00315362 predicted 2222
9 SASI_Hs02_00315363 predicted 2107
10 SASI_Hs02_00315364 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_374768 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264989 predicted 574
2 SASI_Hs01_00264990 predicted 542
3 SASI_Hs01_00264991 predicted 581
4 SASI_Hs01_00264992 predicted 2001
5 SASI_Hs01_00264993 predicted 1865
6 SASI_Hs01_00264994 predicted 967
7 SASI_Hs01_00264995 predicted 520
8 SASI_Hs01_00264996 predicted 895
9 SASI_Hs01_00264997 predicted 2003
10 SASI_Hs01_00264998 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287539 predicted 434
2 SASI_Hs01_00287540 predicted 787
3 SASI_Hs01_00287541 predicted 757
4 SASI_Hs01_00287542 predicted 790
5 SASI_Hs01_00287543 predicted 2212
6 SASI_Hs01_00287544 predicted 2078
7 SASI_Hs01_00287545 predicted 1188
8 SASI_Hs01_00287546 predicted 722
9 SASI_Hs01_00287547 predicted 2223
10 SASI_Hs01_00287548 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252934 predicted 430
2 SASI_Hs01_00252935 predicted 344
3 SASI_Hs01_00252936 predicted 385
4 SASI_Hs01_00252937 predicted 597
5 SASI_Hs01_00252938 predicted 398
6 SASI_Hs01_00252939 predicted 384
7 SASI_Hs01_00252940 predicted 406
8 SASI_Hs01_00252941 predicted 418
9 SASI_Hs01_00252942 predicted 433
10 SASI_Hs01_00252943 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215818 predicted 2734
2 SASI_Rn02_00215819 predicted 1337
3 SASI_Rn02_00215820 predicted 2383
4 SASI_Rn02_00215821 predicted 2266
5 SASI_Rn02_00215822 predicted 2709
6 SASI_Rn02_00215823 predicted 1097
7 SASI_Rn02_00215824 predicted 484
8 SASI_Rn02_00215825 predicted 1973
9 SASI_Rn02_00215826 predicted 1683
10 SASI_Rn02_00215827 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293463 predicted 1650
2 SASI_Mm02_00293464 predicted 729
3 SASI_Mm02_00293465 predicted 1714
4 SASI_Mm02_00293466 predicted 549
5 SASI_Mm02_00293467 predicted 1477
6 SASI_Mm02_00293468 predicted 1760
7 SASI_Mm02_00293469 predicted 2555
8 SASI_Mm02_00293470 predicted 770
9 SASI_Mm02_00293471 predicted 534
10 SASI_Mm02_00293472 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074169 predicted 1486
2 SASI_Mm01_00074170 predicted 568
3 SASI_Mm01_00074171 predicted 1558
4 SASI_Mm01_00074172 predicted 393
5 SASI_Mm01_00074173 predicted 1319
6 SASI_Mm01_00074174 predicted 1598
7 SASI_Mm02_00349737 predicted 2385
8 SASI_Mm01_00074176 predicted 608
9 SASI_Mm01_00074177 predicted 380
10 SASI_Mm01_00074178 predicted 549
11 SASI_Mm01_00074175 predicted 2181
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080491
VALIDATED
USP6NL MISSION shRNA Bacterial Glycerol Stock
USP6 N-terminal like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080491.1-2297s21c1
Sequence:CCGGACATGGTCAGAAGTTAGTTATCTCGAGATAACTAACTTCTGACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080491.1-2438s21c1
Sequence:CCGGGTAGATAGTCCCGTGAGATATCTCGAGATATCTCACGGGACTATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080491.1-1469s21c1
Sequence:CCGGGACAGTTCCAGGCAATATAATCTCGAGATTATATTGCCTGGAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080491.1-2358s21c1
Sequence:CCGGATGCTAGCCGTGGCAATTTACCTCGAGGTAAATTGCCACGGCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080491.1-3862s21c1
Sequence:CCGGAGAGTATGACTTCGTGTTTAACTCGAGTTAAACACGAAGTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080491
VALIDATED
USP6NL MISSION shRNA shRNA Plasmid DNA
USP6 N-terminal like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080491.1-2297s21c1
Sequence:CCGGACATGGTCAGAAGTTAGTTATCTCGAGATAACTAACTTCTGACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080491.1-2438s21c1
Sequence:CCGGGTAGATAGTCCCGTGAGATATCTCGAGATATCTCACGGGACTATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080491.1-1469s21c1
Sequence:CCGGGACAGTTCCAGGCAATATAATCTCGAGATTATATTGCCTGGAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080491.1-2358s21c1
Sequence:CCGGATGCTAGCCGTGGCAATTTACCTCGAGGTAAATTGCCACGGCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080491.1-3862s21c1
Sequence:CCGGAGAGTATGACTTCGTGTTTAACTCGAGTTAAACACGAAGTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080491
VALIDATED
USP6NL MISSION shRNA Lentiviral Transduction Particles
USP6 N-terminal like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080491.1-2297s21c1
Sequence:CCGGACATGGTCAGAAGTTAGTTATCTCGAGATAACTAACTTCTGACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080491.1-2438s21c1
Sequence:CCGGGTAGATAGTCCCGTGAGATATCTCGAGATATCTCACGGGACTATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080491.1-1469s21c1
Sequence:CCGGGACAGTTCCAGGCAATATAATCTCGAGATTATATTGCCTGGAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080491.1-2358s21c1
Sequence:CCGGATGCTAGCCGTGGCAATTTACCTCGAGGTAAATTGCCACGGCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080491.1-3862s21c1
Sequence:CCGGAGAGTATGACTTCGTGTTTAACTCGAGTTAAACACGAAGTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181399
VALIDATED
USP6NL MISSION shRNA Bacterial Glycerol Stock
USP6 N-terminal like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181399.2-411s1c1
Sequence:CCGGCGACGAATTTACAAAGGAATTCTCGAGAATTCCTTTGTAAATTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181399.2-398s1c1
Sequence:CCGGCGAGAAGTTTCATCGACGAATCTCGAGATTCGTCGATGAAACTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181399.2-2113s1c1
Sequence:CCGGCCTCTCTTTCAGTTGACACTTCTCGAGAAGTGTCAACTGAAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181399.2-171s1c1
Sequence:CCGGCGAGCTGAAATAGTTGCTAAACTCGAGTTTAGCAACTATTTCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181399.2-3762s1c1
Sequence:CCGGCCTCTTCTTGTATCTGAATATCTCGAGATATTCAGATACAAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181399
VALIDATED
USP6NL MISSION shRNA shRNA Plasmid DNA
USP6 N-terminal like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181399.2-411s1c1
Sequence:CCGGCGACGAATTTACAAAGGAATTCTCGAGAATTCCTTTGTAAATTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181399.2-398s1c1
Sequence:CCGGCGAGAAGTTTCATCGACGAATCTCGAGATTCGTCGATGAAACTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181399.2-2113s1c1
Sequence:CCGGCCTCTCTTTCAGTTGACACTTCTCGAGAAGTGTCAACTGAAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181399.2-171s1c1
Sequence:CCGGCGAGCTGAAATAGTTGCTAAACTCGAGTTTAGCAACTATTTCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181399.2-3762s1c1
Sequence:CCGGCCTCTTCTTGTATCTGAATATCTCGAGATATTCAGATACAAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181399
VALIDATED
USP6NL MISSION shRNA Lentiviral Transduction Particles
USP6 N-terminal like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181399.2-411s1c1
Sequence:CCGGCGACGAATTTACAAAGGAATTCTCGAGAATTCCTTTGTAAATTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181399.2-398s1c1
Sequence:CCGGCGAGAAGTTTCATCGACGAATCTCGAGATTCGTCGATGAAACTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181399.2-2113s1c1
Sequence:CCGGCCTCTCTTTCAGTTGACACTTCTCGAGAAGTGTCAACTGAAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181399.2-171s1c1
Sequence:CCGGCGAGCTGAAATAGTTGCTAAACTCGAGTTTAGCAACTATTTCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181399.2-3762s1c1
Sequence:CCGGCCTCTTCTTGTATCTGAATATCTCGAGATATTCAGATACAAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks