EMAIL THIS PAGE TO A FRIEND

USP7

ubiquitin specific peptidase 7 (herpes virus-associated)

Synonyms: HAUSP TEF1
UniProtKB ID: Q93009, A6NMY8
Gene ID:
Mouse(252870) ubiquitin specific peptidase 7
Rat(360471) ubiquitin specific peptidase 7 (herpes virus-associated)
fruit fly(32169) ubiquitin-specific protease 7
Zebrafish(553758) ubiquitin specific peptidase 7 (herpes virus-associated)
Horse(100057484) ubiquitin specific peptidase 7 (herpes virus-associated)
domestic cat(101088134) ubiquitin specific peptidase 7 (herpes virus-associated)
dog(479854) ubiquitin specific peptidase 7 (herpes virus-associated)
chicken(395126) ubiquitin specific peptidase 7 (herpes virus-associated)
naked mole-rat(101715332) ubiquitin specific peptidase 7 (herpes virus-associated)
domestic guinea pig(100726431) ubiquitin specific peptidase 7 (herpes virus-associated)
cow(514813) ubiquitin specific peptidase 7 (herpes virus-associated)
sheep(101106735) ubiquitin specific peptidase 7 (herpes virus-associated)
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_148584 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_148584 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_148584 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003470 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003470 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003470 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003918 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003918 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003918 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003470 Rosetta Predictions human pricing
NM_001024790 Rosetta Predictions rat pricing
NM_001003918 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079539 predicted 3095
2 SASI_Hs01_00079540 predicted 2856
3 SASI_Hs02_00335725 predicted 2432
4 SASI_Hs02_00335726 predicted 1479
5 SASI_Hs02_00335727 predicted 2624
6 SASI_Hs01_00079541 predicted 1726
7 SASI_Hs01_00079542 predicted 2810
8 SASI_Hs01_00079543 predicted 1453
9 SASI_Hs01_00079544 predicted 1732
10 SASI_Hs01_00079545 predicted 1739
11 SASI_Hs01_00079546 predicted 3149
12 SASI_Hs01_00079547 predicted 1208
13 SASI_Hs01_00079548 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024790 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111961 predicted 1530
2 SASI_Rn01_00111962 predicted 1384
3 SASI_Rn02_00202699 predicted 1941
4 SASI_Rn02_00202700 predicted 2441
5 SASI_Rn01_00111964 predicted 2103
6 SASI_Rn01_00111965 predicted 2138
7 SASI_Rn01_00111966 predicted 1090
8 SASI_Rn01_00111967 predicted 3004
9 SASI_Rn01_00111968 predicted 2237
10 SASI_Rn01_00111969 predicted 807
11 SASI_Rn01_00111963 predicted 2187
12 SASI_Rn01_00111970 predicted 2616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071333 predicted 1588
2 SASI_Mm02_00286362 predicted 2638
3 SASI_Mm01_00071335 predicted 1994
4 SASI_Mm01_00071337 predicted 2241
5 SASI_Mm01_00071338 predicted 2491
6 SASI_Mm01_00071339 predicted 2200
7 SASI_Mm01_00071340 predicted 3086
8 SASI_Mm01_00071341 predicted 1154
9 SASI_Mm01_00071342 predicted 2924
10 SASI_Mm02_00286363 predicted 2666
11 SASI_Mm01_00071334 predicted 1394
12 SASI_Mm01_00071336 predicted 2430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_148584
VALIDATED
USP7 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 7 (herpes virus-associated)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148584.5-4285s1c1
Sequence:CCGGGCGTAGCTTTATTTGAGTCTTCTCGAGAAGACTCAAATAAAGCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148584.5-2436s1c1
Sequence:CCGGCCCTGGATTTGTGGTCACATTCTCGAGAATGTGACCACAAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148584.5-2235s1c1
Sequence:CCGGGCCGAATTTAACAGAGAGAATCTCGAGATTCTCTCTGTTAAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148584.5-1230s1c1
Sequence:CCGGGCAACTTATGAGGTTCATGTACTCGAGTACATGAACCTCATAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148584.5-1921s1c1
Sequence:CCGGCCTGCAATGTTAGATAATGAACTCGAGTTCATTATCTAACATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_148584
VALIDATED
USP7 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 7 (herpes virus-associated)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148584.5-4285s1c1
Sequence:CCGGGCGTAGCTTTATTTGAGTCTTCTCGAGAAGACTCAAATAAAGCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148584.5-2436s1c1
Sequence:CCGGCCCTGGATTTGTGGTCACATTCTCGAGAATGTGACCACAAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148584.5-2235s1c1
Sequence:CCGGGCCGAATTTAACAGAGAGAATCTCGAGATTCTCTCTGTTAAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148584.5-1230s1c1
Sequence:CCGGGCAACTTATGAGGTTCATGTACTCGAGTACATGAACCTCATAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148584.5-1921s1c1
Sequence:CCGGCCTGCAATGTTAGATAATGAACTCGAGTTCATTATCTAACATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_148584
VALIDATED
USP7 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 7 (herpes virus-associated)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148584.5-4285s1c1
Sequence:CCGGGCGTAGCTTTATTTGAGTCTTCTCGAGAAGACTCAAATAAAGCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148584.5-2436s1c1
Sequence:CCGGCCCTGGATTTGTGGTCACATTCTCGAGAATGTGACCACAAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148584.5-2235s1c1
Sequence:CCGGGCCGAATTTAACAGAGAGAATCTCGAGATTCTCTCTGTTAAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148584.5-1230s1c1
Sequence:CCGGGCAACTTATGAGGTTCATGTACTCGAGTACATGAACCTCATAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148584.5-1921s1c1
Sequence:CCGGCCTGCAATGTTAGATAATGAACTCGAGTTCATTATCTAACATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003470
VALIDATED
USP7 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 7 (herpes virus-associated)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003470.x-3665s1c1
Sequence:CCGGTGTATCTATTGACTGCCCTTTCTCGAGAAAGGGCAGTCAATAGATACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003470.x-2618s1c1
Sequence:CCGGCCTGGATTTGTGGTTACGTTACTCGAGTAACGTAACCACAAATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003470.x-1249s1c1
Sequence:CCGGCCAGCTAAGTATCAAAGGAAACTCGAGTTTCCTTTGATACTTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003470.x-1184s1c1
Sequence:CCGGGTGTCCTATATCCAGTGTAAACTCGAGTTTACACTGGATATAGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003470.x-1648s1c1
Sequence:CCGGCGTGGTGTCAAGGTGTACTAACTCGAGTTAGTACACCTTGACACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003470.2-3665s21c1
Sequence:CCGGTGTATCTATTGACTGCCCTTTCTCGAGAAAGGGCAGTCAATAGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003470.2-1648s21c1
Sequence:CCGGCGTGGTGTCAAGGTGTACTAACTCGAGTTAGTACACCTTGACACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003470.2-1249s21c1
Sequence:CCGGCCAGCTAAGTATCAAAGGAAACTCGAGTTTCCTTTGATACTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003470.2-2618s21c1
Sequence:CCGGCCTGGATTTGTGGTTACGTTACTCGAGTAACGTAACCACAAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003470
VALIDATED
USP7 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 7 (herpes virus-associated)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003470.x-3665s1c1
Sequence:CCGGTGTATCTATTGACTGCCCTTTCTCGAGAAAGGGCAGTCAATAGATACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003470.x-2618s1c1
Sequence:CCGGCCTGGATTTGTGGTTACGTTACTCGAGTAACGTAACCACAAATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003470.x-1249s1c1
Sequence:CCGGCCAGCTAAGTATCAAAGGAAACTCGAGTTTCCTTTGATACTTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003470.x-1184s1c1
Sequence:CCGGGTGTCCTATATCCAGTGTAAACTCGAGTTTACACTGGATATAGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003470.x-1648s1c1
Sequence:CCGGCGTGGTGTCAAGGTGTACTAACTCGAGTTAGTACACCTTGACACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003470.2-3665s21c1
Sequence:CCGGTGTATCTATTGACTGCCCTTTCTCGAGAAAGGGCAGTCAATAGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003470.2-1648s21c1
Sequence:CCGGCGTGGTGTCAAGGTGTACTAACTCGAGTTAGTACACCTTGACACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003470.2-1249s21c1
Sequence:CCGGCCAGCTAAGTATCAAAGGAAACTCGAGTTTCCTTTGATACTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003470.2-2618s21c1
Sequence:CCGGCCTGGATTTGTGGTTACGTTACTCGAGTAACGTAACCACAAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003470
VALIDATED
USP7 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 7 (herpes virus-associated)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003470.x-3665s1c1
Sequence:CCGGTGTATCTATTGACTGCCCTTTCTCGAGAAAGGGCAGTCAATAGATACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003470.x-2618s1c1
Sequence:CCGGCCTGGATTTGTGGTTACGTTACTCGAGTAACGTAACCACAAATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003470.x-1249s1c1
Sequence:CCGGCCAGCTAAGTATCAAAGGAAACTCGAGTTTCCTTTGATACTTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003470.x-1184s1c1
Sequence:CCGGGTGTCCTATATCCAGTGTAAACTCGAGTTTACACTGGATATAGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003470.x-1648s1c1
Sequence:CCGGCGTGGTGTCAAGGTGTACTAACTCGAGTTAGTACACCTTGACACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003470.2-3665s21c1
Sequence:CCGGTGTATCTATTGACTGCCCTTTCTCGAGAAAGGGCAGTCAATAGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003470.2-1648s21c1
Sequence:CCGGCGTGGTGTCAAGGTGTACTAACTCGAGTTAGTACACCTTGACACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003470.2-1249s21c1
Sequence:CCGGCCAGCTAAGTATCAAAGGAAACTCGAGTTTCCTTTGATACTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003470.2-2618s21c1
Sequence:CCGGCCTGGATTTGTGGTTACGTTACTCGAGTAACGTAACCACAAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003918
USP7 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 7 (herpes virus-associated)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003918.2-4327s21c1
Sequence:CCGGGCGTAGCTTTATTTGAGTCTTCTCGAGAAGACTCAAATAAAGCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003918.2-1963s21c1
Sequence:CCGGCCTGCAATGTTAGATAATGAACTCGAGTTCATTATCTAACATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003918.2-2478s21c1
Sequence:CCGGCCCTGGATTTGTGGTCACATTCTCGAGAATGTGACCACAAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003918.2-1272s21c1
Sequence:CCGGGCAACTTATGAGGTTCATGTACTCGAGTACATGAACCTCATAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003918.2-2277s21c1
Sequence:CCGGGCCGAATTTAACAGAGAGAATCTCGAGATTCTCTCTGTTAAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003918
USP7 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 7 (herpes virus-associated)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003918.2-4327s21c1
Sequence:CCGGGCGTAGCTTTATTTGAGTCTTCTCGAGAAGACTCAAATAAAGCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003918.2-1963s21c1
Sequence:CCGGCCTGCAATGTTAGATAATGAACTCGAGTTCATTATCTAACATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003918.2-2478s21c1
Sequence:CCGGCCCTGGATTTGTGGTCACATTCTCGAGAATGTGACCACAAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003918.2-1272s21c1
Sequence:CCGGGCAACTTATGAGGTTCATGTACTCGAGTACATGAACCTCATAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003918.2-2277s21c1
Sequence:CCGGGCCGAATTTAACAGAGAGAATCTCGAGATTCTCTCTGTTAAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003918
USP7 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 7 (herpes virus-associated)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003918.2-4327s21c1
Sequence:CCGGGCGTAGCTTTATTTGAGTCTTCTCGAGAAGACTCAAATAAAGCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003918.2-1963s21c1
Sequence:CCGGCCTGCAATGTTAGATAATGAACTCGAGTTCATTATCTAACATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003918.2-2478s21c1
Sequence:CCGGCCCTGGATTTGTGGTCACATTCTCGAGAATGTGACCACAAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003918.2-1272s21c1
Sequence:CCGGGCAACTTATGAGGTTCATGTACTCGAGTACATGAACCTCATAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003918.2-2277s21c1
Sequence:CCGGGCCGAATTTAACAGAGAGAATCTCGAGATTCTCTCTGTTAAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks