EMAIL THIS PAGE TO A FRIEND

USP8

ubiquitin specific peptidase 8

Synonyms: HumORF8 UBPY
UniProtKB ID: P40818, Q2TB31, Q7Z3U2, Q86VA0, Q8IWI7
Gene ID:
Mouse(84092) ubiquitin specific peptidase 8
Rat(296121) ubiquitin specific peptidase 8
cow(538743) ubiquitin specific peptidase 8
sheep(101106943) ubiquitin specific peptidase 8
domestic guinea pig(100720255) ubiquitin specific peptidase 8
naked mole-rat(101710362) ubiquitin specific peptidase 8
Zebrafish(565434) ubiquitin specific peptidase 8
Horse(100055443) ubiquitin specific peptidase 8
domestic cat(101095663) ubiquitin specific peptidase 8
dog(478299) ubiquitin specific peptidase 8
chicken(415451) ubiquitin specific peptidase 8
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005154 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005154 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005154 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005154 Rosetta Predictions human pricing
NM_001106502 Rosetta Predictions rat pricing
NM_019729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339089 predicted 2097
2 SASI_Hs01_00136039 predicted 1305
3 SASI_Hs01_00136041 predicted 2945
4 SASI_Hs02_00339090 predicted 629
5 SASI_Hs01_00136043 predicted 758
6 SASI_Hs01_00136044 predicted 3548
7 SASI_Hs01_00136045 predicted 2756
8 SASI_Hs01_00136046 predicted 3615
9 SASI_Hs02_00339091 predicted 2295
10 SASI_Hs02_00339092 predicted 3270
11 SASI_Hs01_00136037 predicted 1415
12 SASI_Hs01_00136038 predicted 3027
13 SASI_Hs01_00136040 predicted 2197
14 SASI_Hs01_00136042 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219598 predicted 2476
2 SASI_Rn02_00219599 predicted 2362
3 SASI_Rn02_00219600 predicted 3086
4 SASI_Rn02_00219601 predicted 2872
5 SASI_Rn02_00219602 predicted 2520
6 SASI_Rn02_00219603 predicted 1620
7 SASI_Rn02_00219604 predicted 1412
8 SASI_Rn02_00219605 predicted 1077
9 SASI_Rn02_00219606 predicted 2504
10 SASI_Rn02_00219607 predicted 1822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062925 predicted 2397
2 SASI_Mm01_00062928 predicted 2510
3 SASI_Mm01_00062929 predicted 2472
4 SASI_Mm01_00062930 predicted 2682
5 SASI_Mm01_00062931 predicted 2558
6 SASI_Mm01_00062932 predicted 1196
7 SASI_Mm01_00062933 predicted 513
8 SASI_Mm01_00062934 predicted 389
9 SASI_Mm02_00324869 predicted 489
10 SASI_Mm02_00324870 predicted 819
11 SASI_Mm01_00062926 predicted 1852
12 SASI_Mm01_00062927 predicted 439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019729
VALIDATED
USP8 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019729.2-2970s21c1
Sequence:CCGGCAGGACTGCCTTAGATTATTTCTCGAGAAATAATCTAAGGCAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019729.2-251s21c1
Sequence:CCGGCAATAAGAAGACCGAAGTTAACTCGAGTTAACTTCGGTCTTCTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019729.2-3477s21c1
Sequence:CCGGCCTCACATCTAATGCTTACAACTCGAGTTGTAAGCATTAGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019729.2-2402s21c1
Sequence:CCGGTCTTACTGGACTTCGTAATTTCTCGAGAAATTACGAAGTCCAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019729.2-3183s21c1
Sequence:CCGGGACCTGTCACAGTACGTTATTCTCGAGAATAACGTACTGTGACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019729.2-3146s1c1
Sequence:CCGGGCTGCAAACATCCGTGGATTTCTCGAGAAATCCACGGATGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019729.2-683s1c1
Sequence:CCGGCCAAAGGATTAACGGCGAGAACTCGAGTTCTCGCCGTTAATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019729.2-1117s1c1
Sequence:CCGGCGCAGTTTACAACCAATGCTACTCGAGTAGCATTGGTTGTAAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019729.2-3477s1c1
Sequence:CCGGCCTCACATCTAATGCTTACAACTCGAGTTGTAAGCATTAGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019729.2-2364s1c1
Sequence:CCGGCGGAACCTCAATCCTGTATTTCTCGAGAAATACAGGATTGAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019729
VALIDATED
USP8 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019729.2-2970s21c1
Sequence:CCGGCAGGACTGCCTTAGATTATTTCTCGAGAAATAATCTAAGGCAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019729.2-251s21c1
Sequence:CCGGCAATAAGAAGACCGAAGTTAACTCGAGTTAACTTCGGTCTTCTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019729.2-3477s21c1
Sequence:CCGGCCTCACATCTAATGCTTACAACTCGAGTTGTAAGCATTAGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019729.2-2402s21c1
Sequence:CCGGTCTTACTGGACTTCGTAATTTCTCGAGAAATTACGAAGTCCAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019729.2-3183s21c1
Sequence:CCGGGACCTGTCACAGTACGTTATTCTCGAGAATAACGTACTGTGACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019729.2-3146s1c1
Sequence:CCGGGCTGCAAACATCCGTGGATTTCTCGAGAAATCCACGGATGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019729.2-683s1c1
Sequence:CCGGCCAAAGGATTAACGGCGAGAACTCGAGTTCTCGCCGTTAATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019729.2-1117s1c1
Sequence:CCGGCGCAGTTTACAACCAATGCTACTCGAGTAGCATTGGTTGTAAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019729.2-3477s1c1
Sequence:CCGGCCTCACATCTAATGCTTACAACTCGAGTTGTAAGCATTAGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019729.2-2364s1c1
Sequence:CCGGCGGAACCTCAATCCTGTATTTCTCGAGAAATACAGGATTGAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019729
VALIDATED
USP8 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019729.2-2970s21c1
Sequence:CCGGCAGGACTGCCTTAGATTATTTCTCGAGAAATAATCTAAGGCAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019729.2-251s21c1
Sequence:CCGGCAATAAGAAGACCGAAGTTAACTCGAGTTAACTTCGGTCTTCTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019729.2-3477s21c1
Sequence:CCGGCCTCACATCTAATGCTTACAACTCGAGTTGTAAGCATTAGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019729.2-2402s21c1
Sequence:CCGGTCTTACTGGACTTCGTAATTTCTCGAGAAATTACGAAGTCCAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019729.2-3183s21c1
Sequence:CCGGGACCTGTCACAGTACGTTATTCTCGAGAATAACGTACTGTGACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019729.2-3146s1c1
Sequence:CCGGGCTGCAAACATCCGTGGATTTCTCGAGAAATCCACGGATGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019729.2-683s1c1
Sequence:CCGGCCAAAGGATTAACGGCGAGAACTCGAGTTCTCGCCGTTAATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019729.2-1117s1c1
Sequence:CCGGCGCAGTTTACAACCAATGCTACTCGAGTAGCATTGGTTGTAAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019729.2-3477s1c1
Sequence:CCGGCCTCACATCTAATGCTTACAACTCGAGTTGTAAGCATTAGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019729.2-2364s1c1
Sequence:CCGGCGGAACCTCAATCCTGTATTTCTCGAGAAATACAGGATTGAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005154
VALIDATED
USP8 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005154.3-1411s21c1
Sequence:CCGGCCACAGATTGATCGTACTAAACTCGAGTTTAGTACGATCAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005154.3-2184s21c1
Sequence:CCGGCACTGGAACCTTTCGTTATTACTCGAGTAATAACGAAAGGTTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005154.3-434s21c1
Sequence:CCGGTCAAGCAACAGCAGGATTATTCTCGAGAATAATCCTGCTGTTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005154.3-3675s21c1
Sequence:CCGGGCTGTGTTACTAGCACTATATCTCGAGATATAGTGCTAGTAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005154.3-809s21c1
Sequence:CCGGCTCGAAGAATGCAGGATTATCCTCGAGGATAATCCTGCATTCTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005154.2-3675s1c1
Sequence:CCGGGCTGTGTTACTAGCACTATATCTCGAGATATAGTGCTAGTAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005154.2-2355s1c1
Sequence:CCGGCCCAGATATAACCCAGGCTATCTCGAGATAGCCTGGGTTATATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005154.2-3040s1c1
Sequence:CCGGGCCTTCATGTATTTGTCTCTACTCGAGTAGAGACAAATACATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005154.2-1411s1c1
Sequence:CCGGCCACAGATTGATCGTACTAAACTCGAGTTTAGTACGATCAATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005154.2-1166s1c1
Sequence:CCGGGCCAGAATGAAGAGGTGTCTACTCGAGTAGACACCTCTTCATTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005154
VALIDATED
USP8 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005154.3-1411s21c1
Sequence:CCGGCCACAGATTGATCGTACTAAACTCGAGTTTAGTACGATCAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005154.3-2184s21c1
Sequence:CCGGCACTGGAACCTTTCGTTATTACTCGAGTAATAACGAAAGGTTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005154.3-434s21c1
Sequence:CCGGTCAAGCAACAGCAGGATTATTCTCGAGAATAATCCTGCTGTTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005154.3-3675s21c1
Sequence:CCGGGCTGTGTTACTAGCACTATATCTCGAGATATAGTGCTAGTAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005154.3-809s21c1
Sequence:CCGGCTCGAAGAATGCAGGATTATCCTCGAGGATAATCCTGCATTCTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005154.2-3675s1c1
Sequence:CCGGGCTGTGTTACTAGCACTATATCTCGAGATATAGTGCTAGTAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005154.2-2355s1c1
Sequence:CCGGCCCAGATATAACCCAGGCTATCTCGAGATAGCCTGGGTTATATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005154.2-3040s1c1
Sequence:CCGGGCCTTCATGTATTTGTCTCTACTCGAGTAGAGACAAATACATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005154.2-1411s1c1
Sequence:CCGGCCACAGATTGATCGTACTAAACTCGAGTTTAGTACGATCAATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005154.2-1166s1c1
Sequence:CCGGGCCAGAATGAAGAGGTGTCTACTCGAGTAGACACCTCTTCATTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005154
VALIDATED
USP8 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005154.3-1411s21c1
Sequence:CCGGCCACAGATTGATCGTACTAAACTCGAGTTTAGTACGATCAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005154.3-2184s21c1
Sequence:CCGGCACTGGAACCTTTCGTTATTACTCGAGTAATAACGAAAGGTTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005154.3-434s21c1
Sequence:CCGGTCAAGCAACAGCAGGATTATTCTCGAGAATAATCCTGCTGTTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005154.3-3675s21c1
Sequence:CCGGGCTGTGTTACTAGCACTATATCTCGAGATATAGTGCTAGTAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005154.3-809s21c1
Sequence:CCGGCTCGAAGAATGCAGGATTATCCTCGAGGATAATCCTGCATTCTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005154.2-3675s1c1
Sequence:CCGGGCTGTGTTACTAGCACTATATCTCGAGATATAGTGCTAGTAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005154.2-2355s1c1
Sequence:CCGGCCCAGATATAACCCAGGCTATCTCGAGATAGCCTGGGTTATATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005154.2-3040s1c1
Sequence:CCGGGCCTTCATGTATTTGTCTCTACTCGAGTAGAGACAAATACATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005154.2-1411s1c1
Sequence:CCGGCCACAGATTGATCGTACTAAACTCGAGTTTAGTACGATCAATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005154.2-1166s1c1
Sequence:CCGGGCCAGAATGAAGAGGTGTCTACTCGAGTAGACACCTCTTCATTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks