EMAIL THIS PAGE TO A FRIEND

USP9X

ubiquitin specific peptidase 9, X-linked

Synonyms: DFFRX FAF FAM
UniProtKB ID: Q93008, O75550, Q8WWT3, Q8WX12
Gene ID:
Human(8239) Summary: This gene is a member of the peptidase C19 family and encodes a protein that is similar to ubiquitin-specific proteases. Though this gene is located on the X chromosome, it escapes X-inactivation. Mutations in this gene have been associated with Turner syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(22284) ubiquitin specific peptidase 9, X chromosome
Rat(363445) ubiquitin specific peptidase 9, X-linked
chicken(418569) ubiquitin specific peptidase 9, X-linked
Horse(100050489) ubiquitin specific peptidase 9, X-linked
domestic cat(101089837) ubiquitin specific peptidase 9, X-linked
dog(480885) ubiquitin specific peptidase 9, X-linked
naked mole-rat(101701370) ubiquitin specific peptidase 9, X-linked
Domestic Rabbit(100347181) ubiquitin specific peptidase 9, X-linked
domestic guinea pig(100717091) ubiquitin specific peptidase 9, X-linked
cow(507307) ubiquitin specific peptidase 9, X-linked
sheep(101104124) ubiquitin specific peptidase 9, X-linked
280 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004652 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009481 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009481 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009481 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039591 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039591 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039591 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039590 Rosetta Predictions human pricing
NM_001039591 Rosetta Predictions human pricing
XM_001056701 Rosetta Predictions rat pricing
XM_343766 Rosetta Predictions rat pricing
NM_009481 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026227 predicted 4380
2 SASI_Hs02_00308595 predicted 5336
3 SASI_Hs01_00026228 predicted 3845
4 SASI_Hs01_00026229 predicted 3381
5 SASI_Hs01_00026230 predicted 6220
6 SASI_Hs01_00026231 predicted 1911
7 SASI_Hs01_00026232 predicted 7090
8 SASI_Hs02_00308596 predicted 6435
9 SASI_Hs01_00026234 predicted 4886
10 SASI_Hs01_00026235 predicted 3777
11 SASI_Hs01_00026233 predicted 7055
12 SASI_Hs01_00026236 predicted 7068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031439 predicted 4383
2 SASI_Hs02_00308597 predicted 5341
3 SASI_Hs01_00031440 predicted 3846
4 SASI_Hs01_00031441 predicted 3381
5 SASI_Hs01_00031443 predicted 1908
6 SASI_Hs01_00031444 predicted 7095
7 SASI_Hs02_00308598 predicted 6434
8 SASI_Hs01_00031446 predicted 4893
9 SASI_Hs01_00031447 predicted 3778
10 SASI_Hs01_00031448 predicted 7060
11 SASI_Hs01_00031442 predicted 6222
12 SASI_Hs01_00031445 predicted 7063
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284139 predicted 1072
2 SASI_Rn02_00284140 predicted 7372
3 SASI_Rn02_00284141 predicted 1313
4 SASI_Rn02_00284142 predicted 2904
5 SASI_Rn02_00284143 predicted 6354
6 SASI_Rn02_00284144 predicted 2715
7 SASI_Rn02_00284145 predicted 3119
8 SASI_Rn02_00284146 predicted 3499
9 SASI_Rn02_00284147 predicted 7267
10 SASI_Rn02_00284148 predicted 7356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396259 predicted 1071
2 SASI_Rn02_00396260 predicted 7368
3 SASI_Rn02_00396261 predicted 1314
4 SASI_Rn02_00396262 predicted 2912
5 SASI_Rn02_00396263 predicted 6354
6 SASI_Rn02_00396264 predicted 2716
7 SASI_Rn02_00396265 predicted 3111
8 SASI_Rn02_00396266 predicted 3505
9 SASI_Rn02_00396267 predicted 7267
10 SASI_Rn02_00396268 predicted 7357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009481 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137134 predicted 4147
2 SASI_Mm01_00137135 predicted 1092
3 SASI_Mm01_00137137 predicted 7395
4 SASI_Mm01_00137138 predicted 4214
5 SASI_Mm01_00137139 predicted 6829
6 SASI_Mm02_00316221 predicted 2669
7 SASI_Mm02_00316222 predicted 5308
8 SASI_Mm01_00137140 predicted 3560
9 SASI_Mm01_00137141 predicted 2930
10 SASI_Mm01_00137142 predicted 4495
11 SASI_Mm01_00137136 predicted 3568
12 SASI_Mm01_00137143 predicted 7255
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004652
VALIDATED
USP9X MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 9, X-linked
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007361    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004652.2-7870s1c1
Sequence:CCGGGAGAGTTTATTCACTGTCTTACTCGAGTAAGACAGTGAATAAACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004652.2-163s1c1
Sequence:CCGGCGCCTGATTCTTCCAATGAAACTCGAGTTTCATTGGAAGAATCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004652.2-2262s1c1
Sequence:CCGGCGATTCTTCAAAGCTGTGAATCTCGAGATTCACAGCTTTGAAGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004652.2-5251s1c1
Sequence:CCGGCGACCCTAAACGTAGACATTACTCGAGTAATGTCTACGTTTAGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004652.2-7728s1c1
Sequence:CCGGCCACCTCAAACCAAGGATCAACTCGAGTTGATCCTTGGTTTGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004652
VALIDATED
USP9X MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 9, X-linked
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007361    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004652.2-7870s1c1
Sequence:CCGGGAGAGTTTATTCACTGTCTTACTCGAGTAAGACAGTGAATAAACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004652.2-163s1c1
Sequence:CCGGCGCCTGATTCTTCCAATGAAACTCGAGTTTCATTGGAAGAATCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004652.2-2262s1c1
Sequence:CCGGCGATTCTTCAAAGCTGTGAATCTCGAGATTCACAGCTTTGAAGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004652.2-5251s1c1
Sequence:CCGGCGACCCTAAACGTAGACATTACTCGAGTAATGTCTACGTTTAGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004652.2-7728s1c1
Sequence:CCGGCCACCTCAAACCAAGGATCAACTCGAGTTGATCCTTGGTTTGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004652
VALIDATED
USP9X MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 9, X-linked
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007361    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004652.2-7870s1c1
Sequence:CCGGGAGAGTTTATTCACTGTCTTACTCGAGTAAGACAGTGAATAAACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004652.2-163s1c1
Sequence:CCGGCGCCTGATTCTTCCAATGAAACTCGAGTTTCATTGGAAGAATCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004652.2-2262s1c1
Sequence:CCGGCGATTCTTCAAAGCTGTGAATCTCGAGATTCACAGCTTTGAAGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004652.2-5251s1c1
Sequence:CCGGCGACCCTAAACGTAGACATTACTCGAGTAATGTCTACGTTTAGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004652.2-7728s1c1
Sequence:CCGGCCACCTCAAACCAAGGATCAACTCGAGTTGATCCTTGGTTTGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009481
VALIDATED
USP9X MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 9, X-linked
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009481.1-2324s1c1
Sequence:CCGGCGGCTTAACTTTCTTAGGTTTCTCGAGAAACCTAAGAAAGTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009481.1-2715s1c1
Sequence:CCGGGCCGAGCTATTGATCTCCTTACTCGAGTAAGGAGATCAATAGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009481.1-6464s1c1
Sequence:CCGGGCAGAAGAAATCACTATGATTCTCGAGAATCATAGTGATTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009481.1-4131s1c1
Sequence:CCGGGCCCAAATGAAGAAGTGACAACTCGAGTTGTCACTTCTTCATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009481.1-1027s1c1
Sequence:CCGGCCTCAACAAGTTTGGCACTTTCTCGAGAAAGTGCCAAACTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009481.2-3536s21c1
Sequence:CCGGCCGCCAGATAGTACGACAATACTCGAGTATTGTCGTACTATCTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009481.2-1144s21c1
Sequence:CCGGGATAATTGCAGCCCTTATTAACTCGAGTTAATAAGGGCTGCAATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238351    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009481.2-8120s21c1
Sequence:CCGGTTCTGTGTCTGGCTAATATTTCTCGAGAAATATTAGCCAGACACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009481.2-1452s21c1
Sequence:CCGGATGCACTGAATGAGGTTAATACTCGAGTATTAACCTCATTCAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009481
VALIDATED
USP9X MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 9, X-linked
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009481.1-2324s1c1
Sequence:CCGGCGGCTTAACTTTCTTAGGTTTCTCGAGAAACCTAAGAAAGTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009481.1-2715s1c1
Sequence:CCGGGCCGAGCTATTGATCTCCTTACTCGAGTAAGGAGATCAATAGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009481.1-6464s1c1
Sequence:CCGGGCAGAAGAAATCACTATGATTCTCGAGAATCATAGTGATTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009481.1-4131s1c1
Sequence:CCGGGCCCAAATGAAGAAGTGACAACTCGAGTTGTCACTTCTTCATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009481.1-1027s1c1
Sequence:CCGGCCTCAACAAGTTTGGCACTTTCTCGAGAAAGTGCCAAACTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009481.2-3536s21c1
Sequence:CCGGCCGCCAGATAGTACGACAATACTCGAGTATTGTCGTACTATCTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009481.2-1144s21c1
Sequence:CCGGGATAATTGCAGCCCTTATTAACTCGAGTTAATAAGGGCTGCAATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238351    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009481.2-8120s21c1
Sequence:CCGGTTCTGTGTCTGGCTAATATTTCTCGAGAAATATTAGCCAGACACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009481.2-1452s21c1
Sequence:CCGGATGCACTGAATGAGGTTAATACTCGAGTATTAACCTCATTCAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009481
VALIDATED
USP9X MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 9, X-linked
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009481.1-2324s1c1
Sequence:CCGGCGGCTTAACTTTCTTAGGTTTCTCGAGAAACCTAAGAAAGTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009481.1-2715s1c1
Sequence:CCGGGCCGAGCTATTGATCTCCTTACTCGAGTAAGGAGATCAATAGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009481.1-6464s1c1
Sequence:CCGGGCAGAAGAAATCACTATGATTCTCGAGAATCATAGTGATTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009481.1-4131s1c1
Sequence:CCGGGCCCAAATGAAGAAGTGACAACTCGAGTTGTCACTTCTTCATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009481.1-1027s1c1
Sequence:CCGGCCTCAACAAGTTTGGCACTTTCTCGAGAAAGTGCCAAACTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009481.2-3536s21c1
Sequence:CCGGCCGCCAGATAGTACGACAATACTCGAGTATTGTCGTACTATCTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009481.2-1144s21c1
Sequence:CCGGGATAATTGCAGCCCTTATTAACTCGAGTTAATAAGGGCTGCAATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238351    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009481.2-8120s21c1
Sequence:CCGGTTCTGTGTCTGGCTAATATTTCTCGAGAAATATTAGCCAGACACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009481.2-1452s21c1
Sequence:CCGGATGCACTGAATGAGGTTAATACTCGAGTATTAACCTCATTCAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039591
USP9X MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 9, X-linked
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000350481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039591.2-737s21c1
Sequence:CCGGCGCCTGATTCTTCCAATGAAACTCGAGTTTCATTGGAAGAATCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039591.2-4388s21c1
Sequence:CCGGGGTCGTTACAGCTAGTATTTACTCGAGTAAATACTAGCTGTAACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039591.2-2857s21c1
Sequence:CCGGCGATTCTTCAAAGCTGTGAATCTCGAGATTCACAGCTTTGAAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039591.2-8417s21c1
Sequence:CCGGGAGAGTTTATTCACTGTCTTACTCGAGTAAGACAGTGAATAAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039591
USP9X MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 9, X-linked
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000350481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039591.2-737s21c1
Sequence:CCGGCGCCTGATTCTTCCAATGAAACTCGAGTTTCATTGGAAGAATCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039591.2-4388s21c1
Sequence:CCGGGGTCGTTACAGCTAGTATTTACTCGAGTAAATACTAGCTGTAACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039591.2-2857s21c1
Sequence:CCGGCGATTCTTCAAAGCTGTGAATCTCGAGATTCACAGCTTTGAAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039591.2-8417s21c1
Sequence:CCGGGAGAGTTTATTCACTGTCTTACTCGAGTAAGACAGTGAATAAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039591
USP9X MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 9, X-linked
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000350481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039591.2-737s21c1
Sequence:CCGGCGCCTGATTCTTCCAATGAAACTCGAGTTTCATTGGAAGAATCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039591.2-4388s21c1
Sequence:CCGGGGTCGTTACAGCTAGTATTTACTCGAGTAAATACTAGCTGTAACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039591.2-2857s21c1
Sequence:CCGGCGATTCTTCAAAGCTGTGAATCTCGAGATTCACAGCTTTGAAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039591.2-8417s21c1
Sequence:CCGGGAGAGTTTATTCACTGTCTTACTCGAGTAAGACAGTGAATAAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks