EMAIL THIS PAGE TO A FRIEND

USP9Y

ubiquitin specific peptidase 9, Y-linked

Synonyms: DFFRY SPGFY2
UniProtKB ID: O00507, O14601
Gene ID:
Human(8287) Summary: This gene is a member of the peptidase C19 family. It encodes a protein that is similar to ubiquitin-specific proteases, which cleave the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. [provided by RefSeq, Mar 2009]
Mouse(107868) ubiquitin specific peptidase 9, Y chromosome
cow(100271721) ubiquitin specific peptidase 9, Y-linked
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004654 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004654 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004654 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_148943 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148943 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148943 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148571 MISSION® esiRNA esiRNA human USP9Y (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004654 Rosetta Predictions human pricing
NM_148943 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081909 predicted 5720
2 SASI_Hs02_00338066 predicted 7411
3 SASI_Hs01_00081910 predicted 7419
4 SASI_Hs01_00081911 predicted 6847
5 SASI_Hs01_00081912 predicted 8093
6 SASI_Hs01_00081913 predicted 3396
7 SASI_Hs01_00081914 predicted 6323
8 SASI_Hs01_00081915 predicted 7934
9 SASI_Hs01_00081916 predicted 3488
10 SASI_Hs02_00338067 predicted 4499
11 SASI_Hs01_00081917 predicted 6288
12 SASI_Hs01_00081918 predicted 7096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148943 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177915 predicted 3978
2 SASI_Mm02_00342754 predicted 7205
3 SASI_Mm02_00342755 predicted 2831
4 SASI_Mm01_00177916 predicted 2585
5 SASI_Mm01_00177917 predicted 6042
6 SASI_Mm01_00177918 predicted 6401
7 SASI_Mm02_00342756 predicted 2873
8 SASI_Mm01_00177919 predicted 3784
9 SASI_Mm02_00342757 predicted 6616
10 SASI_Mm02_00342758 predicted 4580
11 SASI_Mm01_00177920 predicted 1079
12 SASI_Mm01_00177921 predicted 6417
13 SASI_Mm01_00177922 predicted 3591
14 SASI_Mm01_00177923 predicted 4627
15 SASI_Mm01_00177924 predicted 2969
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004654
VALIDATED
USP9Y MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 9, Y-linked
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004654.3-5105s21c1
Sequence:CCGGATGCTTACAATGGCAATATTACTCGAGTAATATTGCCATTGTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004654.3-5043s21c1
Sequence:CCGGAGCAAGAGAGAAGGGTAAATACTCGAGTATTTACCCTTCTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004654.3-5727s21c1
Sequence:CCGGTAGTGATTTACACGATGATATCTCGAGATATCATCGTGTAAATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004654.3-8641s21c1
Sequence:CCGGGACTATGCACTAAGGTCTTATCTCGAGATAAGACCTTAGTGCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004654.3-3696s21c1
Sequence:CCGGGCGATGTATTGTTAATCGTATCTCGAGATACGATTAACAATACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004654.2-2221s1c1
Sequence:CCGGGCTCTTACATTACAGGACCTTCTCGAGAAGGTCCTGTAATGTAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004654.2-9147s1c1
Sequence:CCGGGCAGTGTAACATTTCTAGATACTCGAGTATCTAGAAATGTTACACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004654.2-3696s1c1
Sequence:CCGGGCGATGTATTGTTAATCGTATCTCGAGATACGATTAACAATACATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004654.2-4202s1c1
Sequence:CCGGCCTCCCAAGTTCTATACCTAACTCGAGTTAGGTATAGAACTTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004654.2-6331s1c1
Sequence:CCGGGCTATCCAACTCAAACGATTTCTCGAGAAATCGTTTGAGTTGGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004654
VALIDATED
USP9Y MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 9, Y-linked
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004654.3-5105s21c1
Sequence:CCGGATGCTTACAATGGCAATATTACTCGAGTAATATTGCCATTGTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004654.3-5043s21c1
Sequence:CCGGAGCAAGAGAGAAGGGTAAATACTCGAGTATTTACCCTTCTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004654.3-5727s21c1
Sequence:CCGGTAGTGATTTACACGATGATATCTCGAGATATCATCGTGTAAATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004654.3-8641s21c1
Sequence:CCGGGACTATGCACTAAGGTCTTATCTCGAGATAAGACCTTAGTGCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004654.3-3696s21c1
Sequence:CCGGGCGATGTATTGTTAATCGTATCTCGAGATACGATTAACAATACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004654.2-2221s1c1
Sequence:CCGGGCTCTTACATTACAGGACCTTCTCGAGAAGGTCCTGTAATGTAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004654.2-9147s1c1
Sequence:CCGGGCAGTGTAACATTTCTAGATACTCGAGTATCTAGAAATGTTACACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004654.2-3696s1c1
Sequence:CCGGGCGATGTATTGTTAATCGTATCTCGAGATACGATTAACAATACATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004654.2-4202s1c1
Sequence:CCGGCCTCCCAAGTTCTATACCTAACTCGAGTTAGGTATAGAACTTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004654.2-6331s1c1
Sequence:CCGGGCTATCCAACTCAAACGATTTCTCGAGAAATCGTTTGAGTTGGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004654
VALIDATED
USP9Y MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 9, Y-linked
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004654.3-5105s21c1
Sequence:CCGGATGCTTACAATGGCAATATTACTCGAGTAATATTGCCATTGTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004654.3-5043s21c1
Sequence:CCGGAGCAAGAGAGAAGGGTAAATACTCGAGTATTTACCCTTCTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004654.3-5727s21c1
Sequence:CCGGTAGTGATTTACACGATGATATCTCGAGATATCATCGTGTAAATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004654.3-8641s21c1
Sequence:CCGGGACTATGCACTAAGGTCTTATCTCGAGATAAGACCTTAGTGCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004654.3-3696s21c1
Sequence:CCGGGCGATGTATTGTTAATCGTATCTCGAGATACGATTAACAATACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004654.2-2221s1c1
Sequence:CCGGGCTCTTACATTACAGGACCTTCTCGAGAAGGTCCTGTAATGTAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004654.2-9147s1c1
Sequence:CCGGGCAGTGTAACATTTCTAGATACTCGAGTATCTAGAAATGTTACACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004654.2-3696s1c1
Sequence:CCGGGCGATGTATTGTTAATCGTATCTCGAGATACGATTAACAATACATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004654.2-4202s1c1
Sequence:CCGGCCTCCCAAGTTCTATACCTAACTCGAGTTAGGTATAGAACTTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004654.2-6331s1c1
Sequence:CCGGGCTATCCAACTCAAACGATTTCTCGAGAAATCGTTTGAGTTGGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148943
USP9Y MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 9, Y-linked
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148943.1-1688s1c1
Sequence:CCGGGCTCTTACTTTACAGGATCTTCTCGAGAAGATCCTGTAAAGTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148943.1-3460s1c1
Sequence:CCGGGCAGCCCAGATACATATCTTTCTCGAGAAAGATATGTATCTGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148943.1-1175s1c1
Sequence:CCGGGCAGCTCCTATTAAGCCGTTTCTCGAGAAACGGCTTAATAGGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148943.1-7904s1c1
Sequence:CCGGGCACCACAAGATAGAACATTTCTCGAGAAATGTTCTATCTTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148943.1-6371s1c1
Sequence:CCGGCCAGCCATTGAGAGAAGTGTACTCGAGTACACTTCTCTCAATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148943
USP9Y MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 9, Y-linked
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148943.1-1688s1c1
Sequence:CCGGGCTCTTACTTTACAGGATCTTCTCGAGAAGATCCTGTAAAGTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148943.1-3460s1c1
Sequence:CCGGGCAGCCCAGATACATATCTTTCTCGAGAAAGATATGTATCTGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148943.1-1175s1c1
Sequence:CCGGGCAGCTCCTATTAAGCCGTTTCTCGAGAAACGGCTTAATAGGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148943.1-7904s1c1
Sequence:CCGGGCACCACAAGATAGAACATTTCTCGAGAAATGTTCTATCTTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148943.1-6371s1c1
Sequence:CCGGCCAGCCATTGAGAGAAGTGTACTCGAGTACACTTCTCTCAATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148943
USP9Y MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 9, Y-linked
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148943.1-1688s1c1
Sequence:CCGGGCTCTTACTTTACAGGATCTTCTCGAGAAGATCCTGTAAAGTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148943.1-3460s1c1
Sequence:CCGGGCAGCCCAGATACATATCTTTCTCGAGAAAGATATGTATCTGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148943.1-1175s1c1
Sequence:CCGGGCAGCTCCTATTAAGCCGTTTCTCGAGAAACGGCTTAATAGGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148943.1-7904s1c1
Sequence:CCGGGCACCACAAGATAGAACATTTCTCGAGAAATGTTCTATCTTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148943.1-6371s1c1
Sequence:CCGGCCAGCCATTGAGAGAAGTGTACTCGAGTACACTTCTCTCAATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks