EMAIL THIS PAGE TO A FRIEND

USPL1

ubiquitin specific peptidase like 1

Synonyms: C13orf22 D13S106E RP11-121O19.1 bA121O19.1
UniProtKB ID: Q5W0Q7, Q14109, Q6AI45, Q8IY30, Q8IYE8
Gene ID:
Mouse(231915) ubiquitin specific peptidase like 1
Rat(288447) ubiquitin specific peptidase like 1
Thale Cress(841355) BURP domain protein USPL1
Zebrafish(445403) ubiquitin specific peptidase like 1
chicken(395436) ubiquitin specific peptidase like 1
Horse(100062086) ubiquitin specific peptidase like 1
domestic cat(101090070) ubiquitin specific peptidase like 1
dog(486019) ubiquitin specific peptidase like 1
cow(788351) ubiquitin specific peptidase like 1
sheep(101111815) ubiquitin specific peptidase like 1
domestic guinea pig(100722930) ubiquitin specific peptidase like 1
naked mole-rat(101704481) ubiquitin specific peptidase like 1
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005800 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005800 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005800 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013378 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013378 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013378 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005800 Rosetta Predictions human pricing
NM_001105906 Rosetta Predictions rat pricing
NM_001013378 Rosetta Predictions mouse pricing
NM_001115149 Rosetta Predictions mouse pricing
NM_001115150 Rosetta Predictions mouse pricing
NM_001115151 Rosetta Predictions mouse pricing
NM_001115153 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340306 predicted 1674
2 SASI_Hs01_00128479 predicted 1778
3 SASI_Hs01_00128480 predicted 1499
4 SASI_Hs02_00340307 predicted 3253
5 SASI_Hs01_00128481 predicted 1124
6 SASI_Hs01_00128482 predicted 867
7 SASI_Hs01_00128484 predicted 2868
8 SASI_Hs01_00128485 predicted 2191
9 SASI_Hs01_00128486 predicted 922
10 SASI_Hs01_00128487 predicted 2651
11 SASI_Hs01_00128478 predicted 679
12 SASI_Hs01_00128483 predicted 2348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213702 predicted 365
2 SASI_Rn02_00213703 predicted 530
3 SASI_Rn02_00213704 predicted 480
4 SASI_Rn02_00213705 predicted 1345
5 SASI_Rn02_00213706 predicted 606
6 SASI_Rn02_00213707 predicted 218
7 SASI_Rn02_00213708 predicted 619
8 SASI_Rn02_00213709 predicted 474
9 SASI_Rn02_00213710 predicted 453
10 SASI_Rn02_00213711 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188519 predicted 719
2 SASI_Mm01_00188521 predicted 635
3 SASI_Mm01_00188522 predicted 909
4 SASI_Mm01_00188523 predicted 885
5 SASI_Mm01_00188524 predicted 698
6 SASI_Mm02_00287202 predicted 1456
7 SASI_Mm01_00188525 predicted 1403
8 SASI_Mm01_00188526 predicted 1308
9 SASI_Mm01_00188527 predicted 1521
10 SASI_Mm01_00188528 predicted 1433
11 SASI_Mm01_00188520 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308977 predicted 713
2 SASI_Mm02_00308978 predicted 3103
3 SASI_Mm02_00308979 predicted 639
4 SASI_Mm02_00308980 predicted 910
5 SASI_Mm02_00308981 predicted 881
6 SASI_Mm02_00308982 predicted 703
7 SASI_Mm02_00308983 predicted 2682
8 SASI_Mm02_00308984 predicted 1403
9 SASI_Mm02_00308985 predicted 1310
10 SASI_Mm02_00308986 predicted 1519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308987 predicted 2938
2 SASI_Mm02_00308988 predicted 2466
3 SASI_Mm02_00308989 predicted 742
4 SASI_Mm02_00308990 predicted 1293
5 SASI_Mm02_00308991 predicted 2512
6 SASI_Mm02_00308992 predicted 1230
7 SASI_Mm02_00308993 predicted 1140
8 SASI_Mm02_00308994 predicted 1346
9 SASI_Mm02_00308995 predicted 1264
10 SASI_Mm02_00308996 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308997 predicted 1962
2 SASI_Mm02_00308998 predicted 743
3 SASI_Mm02_00308999 predicted 990
4 SASI_Mm02_00309000 predicted 1289
5 SASI_Mm02_00309001 predicted 1232
6 SASI_Mm02_00309002 predicted 1139
7 SASI_Mm02_00309003 predicted 1354
8 SASI_Mm02_00309004 predicted 1265
9 SASI_Mm02_00309005 predicted 1289
10 SASI_Mm02_00309006 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309007 predicted 890
2 SASI_Mm02_00309008 predicted 3281
3 SASI_Mm02_00309009 predicted 817
4 SASI_Mm02_00309010 predicted 1092
5 SASI_Mm02_00309011 predicted 1059
6 SASI_Mm02_00309012 predicted 874
7 SASI_Mm02_00309013 predicted 2857
8 SASI_Mm02_00309014 predicted 1576
9 SASI_Mm02_00309015 predicted 1485
10 SASI_Mm02_00309016 predicted 1697
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005800
VALIDATED
USPL1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005800.3-3675s1c1
Sequence:CCGGACAATGTGTTCAGGTAGTGTTCTCGAGAACACTACCTGAACACATTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005800.3-3582s1c1
Sequence:CCGGCCTACCTCATTTCGATGAATACTCGAGTATTCATCGAAATGAGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005800.3-2129s1c1
Sequence:CCGGCCTCAGTTTCACAGTTAAATTCTCGAGAATTTAACTGTGAAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005800.3-1588s1c1
Sequence:CCGGCCCATATTCATGTTGCACTTTCTCGAGAAAGTGCAACATGAATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005800.3-791s1c1
Sequence:CCGGCGTCAAACTTACCTGATAGTACTCGAGTACTATCAGGTAAGTTTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005800.4-881s21c1
Sequence:CCGGCGTCAAACTTACCTGATAGTACTCGAGTACTATCAGGTAAGTTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005800.4-3596s21c1
Sequence:CCGGGTCCGATGAAGACTGATATTTCTCGAGAAATATCAGTCTTCATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005800.4-1208s21c1
Sequence:CCGGGCTCGAAGGAGGAATCTATATCTCGAGATATAGATTCCTCCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005800.4-2705s21c1
Sequence:CCGGGTTGGGTTAAAGGCTTAATAACTCGAGTTATTAAGCCTTTAACCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005800.4-2219s21c1
Sequence:CCGGCCTCAGTTTCACAGTTAAATTCTCGAGAATTTAACTGTGAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005800
VALIDATED
USPL1 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005800.3-3675s1c1
Sequence:CCGGACAATGTGTTCAGGTAGTGTTCTCGAGAACACTACCTGAACACATTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005800.3-3582s1c1
Sequence:CCGGCCTACCTCATTTCGATGAATACTCGAGTATTCATCGAAATGAGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005800.3-2129s1c1
Sequence:CCGGCCTCAGTTTCACAGTTAAATTCTCGAGAATTTAACTGTGAAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005800.3-1588s1c1
Sequence:CCGGCCCATATTCATGTTGCACTTTCTCGAGAAAGTGCAACATGAATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005800.3-791s1c1
Sequence:CCGGCGTCAAACTTACCTGATAGTACTCGAGTACTATCAGGTAAGTTTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005800.4-881s21c1
Sequence:CCGGCGTCAAACTTACCTGATAGTACTCGAGTACTATCAGGTAAGTTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005800.4-3596s21c1
Sequence:CCGGGTCCGATGAAGACTGATATTTCTCGAGAAATATCAGTCTTCATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005800.4-1208s21c1
Sequence:CCGGGCTCGAAGGAGGAATCTATATCTCGAGATATAGATTCCTCCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005800.4-2705s21c1
Sequence:CCGGGTTGGGTTAAAGGCTTAATAACTCGAGTTATTAAGCCTTTAACCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005800.4-2219s21c1
Sequence:CCGGCCTCAGTTTCACAGTTAAATTCTCGAGAATTTAACTGTGAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005800
VALIDATED
USPL1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005800.3-3675s1c1
Sequence:CCGGACAATGTGTTCAGGTAGTGTTCTCGAGAACACTACCTGAACACATTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005800.3-3582s1c1
Sequence:CCGGCCTACCTCATTTCGATGAATACTCGAGTATTCATCGAAATGAGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005800.3-2129s1c1
Sequence:CCGGCCTCAGTTTCACAGTTAAATTCTCGAGAATTTAACTGTGAAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005800.3-1588s1c1
Sequence:CCGGCCCATATTCATGTTGCACTTTCTCGAGAAAGTGCAACATGAATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005800.3-791s1c1
Sequence:CCGGCGTCAAACTTACCTGATAGTACTCGAGTACTATCAGGTAAGTTTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005800.4-881s21c1
Sequence:CCGGCGTCAAACTTACCTGATAGTACTCGAGTACTATCAGGTAAGTTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005800.4-3596s21c1
Sequence:CCGGGTCCGATGAAGACTGATATTTCTCGAGAAATATCAGTCTTCATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005800.4-1208s21c1
Sequence:CCGGGCTCGAAGGAGGAATCTATATCTCGAGATATAGATTCCTCCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005800.4-2705s21c1
Sequence:CCGGGTTGGGTTAAAGGCTTAATAACTCGAGTTATTAAGCCTTTAACCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005800.4-2219s21c1
Sequence:CCGGCCTCAGTTTCACAGTTAAATTCTCGAGAATTTAACTGTGAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013378
VALIDATED
USPL1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013378.2-1405s21c1
Sequence:CCGGTGGTCACCTTTACCAATATTGCTCGAGCAATATTGGTAAAGGTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013378.2-719s21c1
Sequence:CCGGACCAATTGTGAATGGTAAATACTCGAGTATTTACCATTCACAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013378.2-2182s21c1
Sequence:CCGGAGTATAAGCCGCAGGTCTAAACTCGAGTTTAGACCTGCGGCTTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013378.2-1605s21c1
Sequence:CCGGTATCAAGTCACGTCGGTAATACTCGAGTATTACCGACGTGACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013378.2-1747s21c1
Sequence:CCGGCAGAGACACATATCGTTATTTCTCGAGAAATAACGATATGTGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013378
VALIDATED
USPL1 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013378.2-1405s21c1
Sequence:CCGGTGGTCACCTTTACCAATATTGCTCGAGCAATATTGGTAAAGGTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013378.2-719s21c1
Sequence:CCGGACCAATTGTGAATGGTAAATACTCGAGTATTTACCATTCACAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013378.2-2182s21c1
Sequence:CCGGAGTATAAGCCGCAGGTCTAAACTCGAGTTTAGACCTGCGGCTTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013378.2-1605s21c1
Sequence:CCGGTATCAAGTCACGTCGGTAATACTCGAGTATTACCGACGTGACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013378.2-1747s21c1
Sequence:CCGGCAGAGACACATATCGTTATTTCTCGAGAAATAACGATATGTGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013378
VALIDATED
USPL1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013378.2-1405s21c1
Sequence:CCGGTGGTCACCTTTACCAATATTGCTCGAGCAATATTGGTAAAGGTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013378.2-719s21c1
Sequence:CCGGACCAATTGTGAATGGTAAATACTCGAGTATTTACCATTCACAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013378.2-2182s21c1
Sequence:CCGGAGTATAAGCCGCAGGTCTAAACTCGAGTTTAGACCTGCGGCTTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013378.2-1605s21c1
Sequence:CCGGTATCAAGTCACGTCGGTAATACTCGAGTATTACCGACGTGACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013378.2-1747s21c1
Sequence:CCGGCAGAGACACATATCGTTATTTCTCGAGAAATAACGATATGTGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks