EMAIL THIS PAGE TO A FRIEND

UST

uronyl-2-sulfotransferase

Synonyms: 2OST
UniProtKB ID: Q9Y2C2, B2RCX6
Gene ID:
Human(10090) Summary: Uronyl 2-sulfotransferase transfers sulfate to the 2-position of uronyl residues, such as iduronyl residues in dermatan sulfate and glucuronyl residues in chondroitin sulfate (Kobayashi et al., 1999 [PubMed 10187838]
Mouse(338362) uronyl-2-sulfotransferase
Rat(361450) uronyl-2-sulfotransferase
naked mole-rat(101699506) uronyl-2-sulfotransferase
domestic guinea pig(100718472) uronyl-2-sulfotransferase
cow(535975) uronyl-2-sulfotransferase
sheep(101103732) uronyl-2-sulfotransferase
Zebrafish(557218) uronyl-2-sulfotransferase
domestic cat(101080970) uronyl-2-sulfotransferase
dog(476238) uronyl-2-sulfotransferase
chicken(768809) uronyl-2-sulfotransferase
187 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV46637 Anti-UST antibody produced in rabbit IgG fraction of antiserum human, rat, rabbit, canine, mouse, guinea pig, horse
immunohistochemistry, western blot pricing
HPA032022 Anti-UST antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2105674 Anti-UST, (N-terminal) antibody produced in rabbit affinity isolated antibody human, rabbit, guinea pig, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005715 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177387 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177387 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177387 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005715 Rosetta Predictions human pricing
NM_001108458 Rosetta Predictions rat pricing
NM_177387 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199066 predicted 785
2 SASI_Hs01_00199069 predicted 587
3 SASI_Hs01_00199070 predicted 1121
4 SASI_Hs01_00199071 predicted 774
5 SASI_Hs01_00199072 predicted 1387
6 SASI_Hs02_00340135 predicted 587
7 SASI_Hs01_00199073 predicted 544
8 SASI_Hs01_00199074 predicted 989
9 SASI_Hs01_00199075 predicted 464
10 SASI_Hs02_00340136 predicted 902
11 SASI_Hs01_00199067 predicted 653
12 SASI_Hs01_00199068 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238839 predicted 949
2 SASI_Rn02_00238840 predicted 779
3 SASI_Rn02_00238841 predicted 1176
4 SASI_Rn02_00238842 predicted 843
5 SASI_Rn02_00238843 predicted 1051
6 SASI_Rn02_00238844 predicted 643
7 SASI_Rn02_00238845 predicted 1372
8 SASI_Rn02_00238846 predicted 854
9 SASI_Rn02_00238847 predicted 916
10 SASI_Rn02_00238848 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163475 predicted 1460
2 SASI_Mm01_00163476 predicted 871
3 SASI_Mm01_00163477 predicted 664
4 SASI_Mm01_00163478 predicted 1426
5 SASI_Mm01_00163479 predicted 1315
6 SASI_Mm01_00163480 predicted 904
7 SASI_Mm01_00163481 predicted 998
8 SASI_Mm02_00347567 predicted 1645
9 SASI_Mm01_00163483 predicted 676
10 SASI_Mm01_00163484 predicted 1298
11 SASI_Mm01_00163482 predicted 1235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005715
UST MISSION shRNA Bacterial Glycerol Stock
uronyl-2-sulfotransferase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005715.2-1825s21c1
Sequence:CCGGAGCCTAATAACTTATCATTTGCTCGAGCAAATGATAAGTTATTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005715.2-738s21c1
Sequence:CCGGGAACAAATGGAACTGATTAAACTCGAGTTTAATCAGTTCCATTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005715.2-1370s21c1
Sequence:CCGGGAAGCGCAAGTTTGGACTTAACTCGAGTTAAGTCCAAACTTGCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005715.1-587s1c1
Sequence:CCGGCCCTATTTATTCACTCGACATCTCGAGATGTCGAGTGAATAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005715.1-1262s1c1
Sequence:CCGGGAGCCAATCGACGATGAAGAACTCGAGTTCTTCATCGTCGATTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005715.1-781s1c1
Sequence:CCGGCCTGGATATCAATGAGTGTATCTCGAGATACACTCATTGATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005715.1-380s1c1
Sequence:CCGGCCACCTCCTAGTAAGGTACTACTCGAGTAGTACCTTACTAGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005715.1-1147s1c1
Sequence:CCGGCCACTACGTCAAAGAGCAGTTCTCGAGAACTGCTCTTTGACGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005715
UST MISSION shRNA shRNA Plasmid DNA
uronyl-2-sulfotransferase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005715.2-1825s21c1
Sequence:CCGGAGCCTAATAACTTATCATTTGCTCGAGCAAATGATAAGTTATTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005715.2-738s21c1
Sequence:CCGGGAACAAATGGAACTGATTAAACTCGAGTTTAATCAGTTCCATTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005715.2-1370s21c1
Sequence:CCGGGAAGCGCAAGTTTGGACTTAACTCGAGTTAAGTCCAAACTTGCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005715.1-587s1c1
Sequence:CCGGCCCTATTTATTCACTCGACATCTCGAGATGTCGAGTGAATAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005715.1-1262s1c1
Sequence:CCGGGAGCCAATCGACGATGAAGAACTCGAGTTCTTCATCGTCGATTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005715.1-781s1c1
Sequence:CCGGCCTGGATATCAATGAGTGTATCTCGAGATACACTCATTGATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005715.1-380s1c1
Sequence:CCGGCCACCTCCTAGTAAGGTACTACTCGAGTAGTACCTTACTAGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005715.1-1147s1c1
Sequence:CCGGCCACTACGTCAAAGAGCAGTTCTCGAGAACTGCTCTTTGACGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005715
UST MISSION shRNA Lentiviral Transduction Particles
uronyl-2-sulfotransferase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005715.2-1825s21c1
Sequence:CCGGAGCCTAATAACTTATCATTTGCTCGAGCAAATGATAAGTTATTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005715.2-738s21c1
Sequence:CCGGGAACAAATGGAACTGATTAAACTCGAGTTTAATCAGTTCCATTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005715.2-1370s21c1
Sequence:CCGGGAAGCGCAAGTTTGGACTTAACTCGAGTTAAGTCCAAACTTGCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005715.1-587s1c1
Sequence:CCGGCCCTATTTATTCACTCGACATCTCGAGATGTCGAGTGAATAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005715.1-1262s1c1
Sequence:CCGGGAGCCAATCGACGATGAAGAACTCGAGTTCTTCATCGTCGATTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005715.1-781s1c1
Sequence:CCGGCCTGGATATCAATGAGTGTATCTCGAGATACACTCATTGATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005715.1-380s1c1
Sequence:CCGGCCACCTCCTAGTAAGGTACTACTCGAGTAGTACCTTACTAGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005715.1-1147s1c1
Sequence:CCGGCCACTACGTCAAAGAGCAGTTCTCGAGAACTGCTCTTTGACGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177387
UST MISSION shRNA Bacterial Glycerol Stock
uronyl-2-sulfotransferase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000103065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177387.2-949s1c1
Sequence:CCGGCGTCAGTAGATTTCTGTCTAACTCGAGTTAGACAGAAATCTACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177387.2-860s1c1
Sequence:CCGGCCCTATTTATTCACGAGACATCTCGAGATGTCTCGTGAATAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177387.2-1379s1c1
Sequence:CCGGGCAGATTCTCTACCAGCGAATCTCGAGATTCGCTGGTAGAGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177387.2-1391s1c1
Sequence:CCGGCCAGCGAATGAGATACGAGTACTCGAGTACTCGTATCTCATTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177387
UST MISSION shRNA shRNA Plasmid DNA
uronyl-2-sulfotransferase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000103065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177387.2-949s1c1
Sequence:CCGGCGTCAGTAGATTTCTGTCTAACTCGAGTTAGACAGAAATCTACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177387.2-860s1c1
Sequence:CCGGCCCTATTTATTCACGAGACATCTCGAGATGTCTCGTGAATAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177387.2-1379s1c1
Sequence:CCGGGCAGATTCTCTACCAGCGAATCTCGAGATTCGCTGGTAGAGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177387.2-1391s1c1
Sequence:CCGGCCAGCGAATGAGATACGAGTACTCGAGTACTCGTATCTCATTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177387
UST MISSION shRNA Lentiviral Transduction Particles
uronyl-2-sulfotransferase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000103065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177387.2-949s1c1
Sequence:CCGGCGTCAGTAGATTTCTGTCTAACTCGAGTTAGACAGAAATCTACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177387.2-860s1c1
Sequence:CCGGCCCTATTTATTCACGAGACATCTCGAGATGTCTCGTGAATAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177387.2-1379s1c1
Sequence:CCGGGCAGATTCTCTACCAGCGAATCTCGAGATTCGCTGGTAGAGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177387.2-1391s1c1
Sequence:CCGGCCAGCGAATGAGATACGAGTACTCGAGTACTCGTATCTCATTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks