EMAIL THIS PAGE TO A FRIEND

UTF1

undifferentiated embryonic cell transcription factor 1

UniProtKB ID: Q5T230, O75833, Q6J1H3
Gene ID:
Mouse(22286) undifferentiated embryonic cell transcription factor 1
Rat(681901) undifferentiated embryonic cell transcription factor 1
cow(616910) undifferentiated embryonic cell transcription factor 1
sheep(101111332) undifferentiated embryonic cell transcription factor 1
domestic guinea pig(100727358) undifferentiated embryonic cell transcription factor 1
naked mole-rat(101702360) undifferentiated embryonic cell transcription factor 1
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009482 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009482 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009482 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003577 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003577 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003577 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU019321 MISSION® esiRNA esiRNA targeting mouse Utf1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003577 Rosetta Predictions human pricing
NM_001131032 Rosetta Predictions rat pricing
NM_009482 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220107 predicted 533
2 SASI_Hs01_00220108 predicted 193
3 SASI_Hs01_00220109 predicted 410
4 SASI_Hs01_00220110 predicted 945
5 SASI_Hs01_00220111 predicted 960
6 SASI_Hs01_00220112 predicted 413
7 SASI_Hs01_00220113 predicted 411
8 SASI_Hs01_00220114 predicted 359
9 SASI_Hs01_00220115 predicted 358
10 SASI_Hs02_00335891 predicted 406
11 SASI_Hs01_00220106 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001131032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256199 predicted 756
2 SASI_Rn02_00256200 predicted 347
3 SASI_Rn02_00256201 predicted 608
4 SASI_Rn02_00256202 predicted 807
5 SASI_Rn02_00256203 predicted 274
6 SASI_Rn02_00256204 predicted 518
7 SASI_Rn02_00256205 predicted 600
8 SASI_Rn02_00256206 predicted 751
9 SASI_Rn02_00256207 predicted 465
10 SASI_Rn02_00256208 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009482 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084111 predicted 348
2 SASI_Mm01_00084112 predicted 766
3 SASI_Mm01_00084113 predicted 933
4 SASI_Mm01_00084114 predicted 612
5 SASI_Mm02_00316223 predicted 857
6 SASI_Mm01_00084115 predicted 245
7 SASI_Mm01_00084116 predicted 357
8 SASI_Mm01_00084117 predicted 854
9 SASI_Mm01_00084118 predicted 663
10 SASI_Mm01_00084120 predicted 678
11 SASI_Mm01_00084119 predicted 920
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009482
UTF1 MISSION shRNA Bacterial Glycerol Stock
undifferentiated embryonic cell transcription factor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009482.1-250s1c1
Sequence:CCGGCCGGCCATGTGGCGCTCACTACTCGAGTAGTGAGCGCCACATGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009482.1-828s1c1
Sequence:CCGGCCAGTCGTTGAATACCGCGTTCTCGAGAACGCGGTATTCAACGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009482.1-417s1c1
Sequence:CCGGCGGACCCTTCGATAACCAGATCTCGAGATCTGGTTATCGAAGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009482.1-951s1c1
Sequence:CCGGCTTCGACCAAACCGTTTCTCTCTCGAGAGAGAAACGGTTTGGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009482.1-363s1c1
Sequence:CCGGCCGTCGCTACAAGTTCCTCAACTCGAGTTGAGGAACTTGTAGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009482.2-865s21c1
Sequence:CCGGCACTTGGGCGACATCTCAACACTCGAGTGTTGAGATGTCGCCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009482.2-115s21c1
Sequence:CCGGACGTCTGATGCCTTCGCTACTCTCGAGAGTAGCGAAGGCATCAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009482.2-213s21c1
Sequence:CCGGCCGAGAGACGGAGCTACTTCTCTCGAGAGAAGTAGCTCCGTCTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009482
UTF1 MISSION shRNA shRNA Plasmid DNA
undifferentiated embryonic cell transcription factor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009482.1-250s1c1
Sequence:CCGGCCGGCCATGTGGCGCTCACTACTCGAGTAGTGAGCGCCACATGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009482.1-828s1c1
Sequence:CCGGCCAGTCGTTGAATACCGCGTTCTCGAGAACGCGGTATTCAACGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009482.1-417s1c1
Sequence:CCGGCGGACCCTTCGATAACCAGATCTCGAGATCTGGTTATCGAAGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009482.1-951s1c1
Sequence:CCGGCTTCGACCAAACCGTTTCTCTCTCGAGAGAGAAACGGTTTGGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009482.1-363s1c1
Sequence:CCGGCCGTCGCTACAAGTTCCTCAACTCGAGTTGAGGAACTTGTAGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009482.2-865s21c1
Sequence:CCGGCACTTGGGCGACATCTCAACACTCGAGTGTTGAGATGTCGCCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009482.2-115s21c1
Sequence:CCGGACGTCTGATGCCTTCGCTACTCTCGAGAGTAGCGAAGGCATCAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009482.2-213s21c1
Sequence:CCGGCCGAGAGACGGAGCTACTTCTCTCGAGAGAAGTAGCTCCGTCTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009482
UTF1 MISSION shRNA Lentiviral Transduction Particles
undifferentiated embryonic cell transcription factor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009482.1-250s1c1
Sequence:CCGGCCGGCCATGTGGCGCTCACTACTCGAGTAGTGAGCGCCACATGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009482.1-828s1c1
Sequence:CCGGCCAGTCGTTGAATACCGCGTTCTCGAGAACGCGGTATTCAACGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009482.1-417s1c1
Sequence:CCGGCGGACCCTTCGATAACCAGATCTCGAGATCTGGTTATCGAAGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009482.1-951s1c1
Sequence:CCGGCTTCGACCAAACCGTTTCTCTCTCGAGAGAGAAACGGTTTGGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009482.1-363s1c1
Sequence:CCGGCCGTCGCTACAAGTTCCTCAACTCGAGTTGAGGAACTTGTAGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009482.2-865s21c1
Sequence:CCGGCACTTGGGCGACATCTCAACACTCGAGTGTTGAGATGTCGCCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009482.2-115s21c1
Sequence:CCGGACGTCTGATGCCTTCGCTACTCTCGAGAGTAGCGAAGGCATCAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009482.2-213s21c1
Sequence:CCGGCCGAGAGACGGAGCTACTTCTCTCGAGAGAAGTAGCTCCGTCTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003577
UTF1 MISSION shRNA Bacterial Glycerol Stock
undifferentiated embryonic cell transcription factor 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003577.1-361s1c1
Sequence:CCGGCGCCGCTACAAGTTCCTTAAACTCGAGTTTAAGGAACTTGTAGCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003577.1-912s1c1
Sequence:CCGGGCTGCTGACCTTGAACCAGCACTCGAGTGCTGGTTCAAGGTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003577.1-375s1c1
Sequence:CCGGCCTTAAAGACAAGTTTCGCGACTCGAGTCGCGAAACTTGTCTTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003577.2-421s21c1
Sequence:CCGGTTCGACGAGCAGATCCGGAAGCTCGAGCTTCCGGATCTGCTCGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003577.2-362s21c1
Sequence:CCGGGCCGCTACAAGTTCCTTAAAGCTCGAGCTTTAAGGAACTTGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003577.2-955s21c1
Sequence:CCGGTTCGACCAGACAGTGTCCCTGCTCGAGCAGGGACACTGTCTGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003577.2-608s21c1
Sequence:CCGGCCACCTGGACGCTCCGCTTCACTCGAGTGAAGCGGAGCGTCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003577
UTF1 MISSION shRNA shRNA Plasmid DNA
undifferentiated embryonic cell transcription factor 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003577.1-361s1c1
Sequence:CCGGCGCCGCTACAAGTTCCTTAAACTCGAGTTTAAGGAACTTGTAGCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003577.1-912s1c1
Sequence:CCGGGCTGCTGACCTTGAACCAGCACTCGAGTGCTGGTTCAAGGTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003577.1-375s1c1
Sequence:CCGGCCTTAAAGACAAGTTTCGCGACTCGAGTCGCGAAACTTGTCTTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003577.2-421s21c1
Sequence:CCGGTTCGACGAGCAGATCCGGAAGCTCGAGCTTCCGGATCTGCTCGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003577.2-362s21c1
Sequence:CCGGGCCGCTACAAGTTCCTTAAAGCTCGAGCTTTAAGGAACTTGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003577.2-955s21c1
Sequence:CCGGTTCGACCAGACAGTGTCCCTGCTCGAGCAGGGACACTGTCTGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003577.2-608s21c1
Sequence:CCGGCCACCTGGACGCTCCGCTTCACTCGAGTGAAGCGGAGCGTCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003577
UTF1 MISSION shRNA Lentiviral Transduction Particles
undifferentiated embryonic cell transcription factor 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003577.1-361s1c1
Sequence:CCGGCGCCGCTACAAGTTCCTTAAACTCGAGTTTAAGGAACTTGTAGCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003577.1-912s1c1
Sequence:CCGGGCTGCTGACCTTGAACCAGCACTCGAGTGCTGGTTCAAGGTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003577.1-375s1c1
Sequence:CCGGCCTTAAAGACAAGTTTCGCGACTCGAGTCGCGAAACTTGTCTTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003577.2-421s21c1
Sequence:CCGGTTCGACGAGCAGATCCGGAAGCTCGAGCTTCCGGATCTGCTCGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003577.2-362s21c1
Sequence:CCGGGCCGCTACAAGTTCCTTAAAGCTCGAGCTTTAAGGAACTTGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003577.2-955s21c1
Sequence:CCGGTTCGACCAGACAGTGTCCCTGCTCGAGCAGGGACACTGTCTGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003577.2-608s21c1
Sequence:CCGGCCACCTGGACGCTCCGCTTCACTCGAGTGAAGCGGAGCGTCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks