EMAIL THIS PAGE TO A FRIEND

UTP11L

UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)

Synonyms: CGI94
UniProtKB ID: Q9Y3A2, A8K785, D3DPT7, Q5VT93, Q9BS98, Q9NS31
Gene ID:
Mouse(67205) UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
Rat(313581) UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
Zebrafish(336149) UTP11-like, U3 small nucleolar ribonucleoprotein (yeast)
chicken(419606) UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
domestic cat(101093449) UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
dog(475325) UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
naked mole-rat(101706490) UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
domestic guinea pig(100715092) UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
cow(537675) UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
sheep(101117458) UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016037 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016037 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016037 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026031 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026031 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026031 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016037 Rosetta Predictions human pricing
NM_001107978 Rosetta Predictions rat pricing
NM_026031 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088118 predicted 381
2 SASI_Hs01_00088119 predicted 746
3 SASI_Hs01_00088120 predicted 571
4 SASI_Hs02_00348748 predicted 486
5 SASI_Hs01_00088122 predicted 711
6 SASI_Hs02_00348749 predicted 846
7 SASI_Hs01_00088123 predicted 359
8 SASI_Hs01_00088124 predicted 630
9 SASI_Hs01_00088125 predicted 813
10 SASI_Hs02_00348750 predicted 594
11 SASI_Hs01_00088121 predicted 727
12 SASI_Hs01_00088126 predicted 294
13 SASI_Hs01_00088127 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234155 predicted 1009
2 SASI_Rn02_00234156 predicted 549
3 SASI_Rn02_00234157 predicted 794
4 SASI_Rn02_00234158 predicted 1035
5 SASI_Rn02_00234159 predicted 973
6 SASI_Rn02_00234160 predicted 1061
7 SASI_Rn02_00234161 predicted 1068
8 SASI_Rn02_00234162 predicted 1032
9 SASI_Rn02_00234163 predicted 812
10 SASI_Rn02_00234164 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102605 predicted 347
2 SASI_Mm01_00102606 predicted 236
3 SASI_Mm01_00102607 predicted 706
4 SASI_Mm01_00102608 predicted 332
5 SASI_Mm01_00102609 predicted 606
6 SASI_Mm01_00102610 predicted 326
7 SASI_Mm01_00102611 predicted 373
8 SASI_Mm02_00329506 predicted 344
9 SASI_Mm01_00102612 predicted 449
10 SASI_Mm01_00102613 predicted 637
11 SASI_Mm01_00102614 predicted 565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016037
VALIDATED
UTP11L MISSION shRNA Bacterial Glycerol Stock
UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016037.3-571s21c1
Sequence:CCGGGCTAGTCGACAGAGTCTTTAACTCGAGTTAAAGACTCTGTCGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016037.3-484s21c1
Sequence:CCGGGCAACAGAACAAGCATGTGTTCTCGAGAACACATGCTTGTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016037.3-584s21c1
Sequence:CCGGGTCTTTAATAGGCCCAGGATACTCGAGTATCCTGGGCCTATTAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016037.3-379s21c1
Sequence:CCGGGATGAGAACTCAGGACGTCAACTCGAGTTGACGTCCTGAGTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016037.1-357s1c1
Sequence:CCGGGATGAGAACTCAGGACGTCAACTCGAGTTGACGTCCTGAGTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016037.1-211s1c1
Sequence:CCGGCAAGAATACCTCAAAGCTCTTCTCGAGAAGAGCTTTGAGGTATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016037.1-339s1c1
Sequence:CCGGCCCAGAACAACTAAAGCTGATCTCGAGATCAGCTTTAGTTGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016037.1-622s1c1
Sequence:CCGGCAGACTGGACTTAAGCGAATACTCGAGTATTCGCTTAAGTCCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016037.1-562s1c1
Sequence:CCGGGTCTTTAATAGGCCCAGGATACTCGAGTATCCTGGGCCTATTAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016037.1-462s1c1
Sequence:CCGGGCAACAGAACAAGCATGTGTTCTCGAGAACACATGCTTGTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016037.1-549s1c1
Sequence:CCGGGCTAGTCGACAGAGTCTTTAACTCGAGTTAAAGACTCTGTCGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016037.1-508s1c1
Sequence:CCGGGAACAGTTTGATGTCGCAACTCTCGAGAGTTGCGACATCAAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016037.1-681s1c1
Sequence:CCGGGCGGATTGAACGAGAGAAGAACTCGAGTTCTTCTCTCGTTCAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016037.1-229s1c1
Sequence:CCGGCTTCGGAAGAAGGCTCTTGAACTCGAGTTCAAGAGCCTTCTTCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016037
VALIDATED
UTP11L MISSION shRNA shRNA Plasmid DNA
UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016037.3-571s21c1
Sequence:CCGGGCTAGTCGACAGAGTCTTTAACTCGAGTTAAAGACTCTGTCGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016037.3-484s21c1
Sequence:CCGGGCAACAGAACAAGCATGTGTTCTCGAGAACACATGCTTGTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016037.3-584s21c1
Sequence:CCGGGTCTTTAATAGGCCCAGGATACTCGAGTATCCTGGGCCTATTAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016037.3-379s21c1
Sequence:CCGGGATGAGAACTCAGGACGTCAACTCGAGTTGACGTCCTGAGTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016037.1-357s1c1
Sequence:CCGGGATGAGAACTCAGGACGTCAACTCGAGTTGACGTCCTGAGTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016037.1-211s1c1
Sequence:CCGGCAAGAATACCTCAAAGCTCTTCTCGAGAAGAGCTTTGAGGTATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016037.1-339s1c1
Sequence:CCGGCCCAGAACAACTAAAGCTGATCTCGAGATCAGCTTTAGTTGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016037.1-622s1c1
Sequence:CCGGCAGACTGGACTTAAGCGAATACTCGAGTATTCGCTTAAGTCCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016037.1-562s1c1
Sequence:CCGGGTCTTTAATAGGCCCAGGATACTCGAGTATCCTGGGCCTATTAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016037.1-462s1c1
Sequence:CCGGGCAACAGAACAAGCATGTGTTCTCGAGAACACATGCTTGTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016037.1-549s1c1
Sequence:CCGGGCTAGTCGACAGAGTCTTTAACTCGAGTTAAAGACTCTGTCGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016037.1-508s1c1
Sequence:CCGGGAACAGTTTGATGTCGCAACTCTCGAGAGTTGCGACATCAAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016037.1-681s1c1
Sequence:CCGGGCGGATTGAACGAGAGAAGAACTCGAGTTCTTCTCTCGTTCAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016037.1-229s1c1
Sequence:CCGGCTTCGGAAGAAGGCTCTTGAACTCGAGTTCAAGAGCCTTCTTCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016037
VALIDATED
UTP11L MISSION shRNA Lentiviral Transduction Particles
UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016037.3-571s21c1
Sequence:CCGGGCTAGTCGACAGAGTCTTTAACTCGAGTTAAAGACTCTGTCGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016037.3-484s21c1
Sequence:CCGGGCAACAGAACAAGCATGTGTTCTCGAGAACACATGCTTGTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016037.3-584s21c1
Sequence:CCGGGTCTTTAATAGGCCCAGGATACTCGAGTATCCTGGGCCTATTAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016037.3-379s21c1
Sequence:CCGGGATGAGAACTCAGGACGTCAACTCGAGTTGACGTCCTGAGTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016037.1-357s1c1
Sequence:CCGGGATGAGAACTCAGGACGTCAACTCGAGTTGACGTCCTGAGTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016037.1-211s1c1
Sequence:CCGGCAAGAATACCTCAAAGCTCTTCTCGAGAAGAGCTTTGAGGTATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016037.1-339s1c1
Sequence:CCGGCCCAGAACAACTAAAGCTGATCTCGAGATCAGCTTTAGTTGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016037.1-622s1c1
Sequence:CCGGCAGACTGGACTTAAGCGAATACTCGAGTATTCGCTTAAGTCCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016037.1-562s1c1
Sequence:CCGGGTCTTTAATAGGCCCAGGATACTCGAGTATCCTGGGCCTATTAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016037.1-462s1c1
Sequence:CCGGGCAACAGAACAAGCATGTGTTCTCGAGAACACATGCTTGTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016037.1-549s1c1
Sequence:CCGGGCTAGTCGACAGAGTCTTTAACTCGAGTTAAAGACTCTGTCGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016037.1-508s1c1
Sequence:CCGGGAACAGTTTGATGTCGCAACTCTCGAGAGTTGCGACATCAAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016037.1-681s1c1
Sequence:CCGGGCGGATTGAACGAGAGAAGAACTCGAGTTCTTCTCTCGTTCAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016037.1-229s1c1
Sequence:CCGGCTTCGGAAGAAGGCTCTTGAACTCGAGTTCAAGAGCCTTCTTCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026031
VALIDATED
UTP11L MISSION shRNA Bacterial Glycerol Stock
UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026031.3-485s21c1
Sequence:CCGGGAAGTTGAACGGTTTGATGTTCTCGAGAACATCAAACCGTTCAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026031.3-170s21c1
Sequence:CCGGCGTGCAAATGACTATCATAAACTCGAGTTTATGATAGTCATTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026031.3-740s21c1
Sequence:CCGGCAGAAGGTGAAGGTGAAGAAACTCGAGTTTCTTCACCTTCACCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026031.3-496s21c1
Sequence:CCGGGTTTGATGTTGCAACTCACTTCTCGAGAAGTGAGTTGCAACATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026031.1-497s1c1
Sequence:CCGGGTTTGATGTTGCAACTCACTTCTCGAGAAGTGAGTTGCAACATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026031.1-171s1c1
Sequence:CCGGCGTGCAAATGACTATCATAAACTCGAGTTTATGATAGTCATTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026031.1-623s1c1
Sequence:CCGGGATAGCCAAGGAACGACAGAACTCGAGTTCTGTCGTTCCTTGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026031.1-741s1c1
Sequence:CCGGCAGAAGGTGAAGGTGAAGAAACTCGAGTTTCTTCACCTTCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026031.1-486s1c1
Sequence:CCGGGAAGTTGAACGGTTTGATGTTCTCGAGAACATCAAACCGTTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026031
VALIDATED
UTP11L MISSION shRNA shRNA Plasmid DNA
UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026031.3-485s21c1
Sequence:CCGGGAAGTTGAACGGTTTGATGTTCTCGAGAACATCAAACCGTTCAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026031.3-170s21c1
Sequence:CCGGCGTGCAAATGACTATCATAAACTCGAGTTTATGATAGTCATTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026031.3-740s21c1
Sequence:CCGGCAGAAGGTGAAGGTGAAGAAACTCGAGTTTCTTCACCTTCACCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026031.3-496s21c1
Sequence:CCGGGTTTGATGTTGCAACTCACTTCTCGAGAAGTGAGTTGCAACATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026031.1-497s1c1
Sequence:CCGGGTTTGATGTTGCAACTCACTTCTCGAGAAGTGAGTTGCAACATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026031.1-171s1c1
Sequence:CCGGCGTGCAAATGACTATCATAAACTCGAGTTTATGATAGTCATTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026031.1-623s1c1
Sequence:CCGGGATAGCCAAGGAACGACAGAACTCGAGTTCTGTCGTTCCTTGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026031.1-741s1c1
Sequence:CCGGCAGAAGGTGAAGGTGAAGAAACTCGAGTTTCTTCACCTTCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026031.1-486s1c1
Sequence:CCGGGAAGTTGAACGGTTTGATGTTCTCGAGAACATCAAACCGTTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026031
VALIDATED
UTP11L MISSION shRNA Lentiviral Transduction Particles
UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026031.3-485s21c1
Sequence:CCGGGAAGTTGAACGGTTTGATGTTCTCGAGAACATCAAACCGTTCAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026031.3-170s21c1
Sequence:CCGGCGTGCAAATGACTATCATAAACTCGAGTTTATGATAGTCATTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026031.3-740s21c1
Sequence:CCGGCAGAAGGTGAAGGTGAAGAAACTCGAGTTTCTTCACCTTCACCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026031.3-496s21c1
Sequence:CCGGGTTTGATGTTGCAACTCACTTCTCGAGAAGTGAGTTGCAACATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026031.1-497s1c1
Sequence:CCGGGTTTGATGTTGCAACTCACTTCTCGAGAAGTGAGTTGCAACATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026031.1-171s1c1
Sequence:CCGGCGTGCAAATGACTATCATAAACTCGAGTTTATGATAGTCATTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026031.1-623s1c1
Sequence:CCGGGATAGCCAAGGAACGACAGAACTCGAGTTCTGTCGTTCCTTGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026031.1-741s1c1
Sequence:CCGGCAGAAGGTGAAGGTGAAGAAACTCGAGTTTCTTCACCTTCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026031.1-486s1c1
Sequence:CCGGGAAGTTGAACGGTTTGATGTTCTCGAGAACATCAAACCGTTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks