EMAIL THIS PAGE TO A FRIEND

UTP14A

UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)

Synonyms: NYCO16 SDCCAG16 dJ537K23.3
UniProtKB ID: Q9BVJ6, A8K7A3, A8MVQ1, B4DQ08, E9PEL7, Q5JYF1
Gene ID:
Human(10813) Summary: This gene encodes a member of the uridine triphosphate 14 family. As an essential component of a large ribonucleoprotein complex bound to the U3 small nucleolar RNA, the encoded protein is involved in ribosome biogenesis and 18S rRNA synthesis. An autosomal retrotransposed copy of this X-linked gene exists on chromosome 13. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Mouse(72554) UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
Rat(317579) UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
cow(505324) UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
sheep(101120809) UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
domestic guinea pig(100735421) UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
naked mole-rat(101726215) UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
Domestic Rabbit(100347274) UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
chicken(422140) UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
dog(492128) UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
domestic cat(101080621) UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
Horse(100058946) UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408793 Anti-UTP14A antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB4500165 Anti-UTP14A antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
SAB2105819 Anti-UTP14A, (N-terminal) antibody produced in rabbit affinity isolated antibody rabbit, human, horse, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006649 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028276 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028276 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028276 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026551 MISSION® esiRNA esiRNA targeting mouse Utp14a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006649 Rosetta Predictions human pricing
NM_001014113 Rosetta Predictions rat pricing
NM_028276 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055012 predicted 1726
2 SASI_Hs01_00055013 predicted 1094
3 SASI_Hs01_00055014 predicted 1397
4 SASI_Hs01_00055015 predicted 1692
5 SASI_Hs01_00055016 predicted 399
6 SASI_Hs01_00055017 predicted 1546
7 SASI_Hs01_00055018 predicted 1543
8 SASI_Hs01_00055019 predicted 1727
9 SASI_Hs01_00055020 predicted 1406
10 SASI_Hs01_00055021 predicted 1786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014113 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111800 predicted 1409
2 SASI_Rn01_00111801 predicted 238
3 SASI_Rn01_00111802 predicted 304
4 SASI_Rn01_00111803 predicted 890
5 SASI_Rn01_00111804 predicted 324
6 SASI_Rn01_00111806 predicted 2200
7 SASI_Rn01_00111807 predicted 2004
8 SASI_Rn01_00111808 predicted 1550
9 SASI_Rn01_00111809 predicted 1158
10 SASI_Rn02_00201555 predicted 454
11 SASI_Rn01_00111805 predicted 1712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028276 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031323 predicted 281
2 SASI_Mm01_00031324 predicted 1357
3 SASI_Mm01_00031325 predicted 2170
4 SASI_Mm01_00031326 predicted 1663
5 SASI_Mm01_00031327 predicted 373
6 SASI_Mm01_00031328 predicted 2095
7 SASI_Mm01_00031330 predicted 340
8 SASI_Mm01_00031331 predicted 1530
9 SASI_Mm01_00031332 predicted 1069
10 SASI_Mm02_00333636 predicted 867
11 SASI_Mm01_00031329 predicted 1395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006649
UTP14A MISSION shRNA Bacterial Glycerol Stock
UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006649.2-997s1c1
Sequence:CCGGGCAGGAACAGTTGTCTAAGAACTCGAGTTCTTAGACAACTGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006649.2-1118s1c1
Sequence:CCGGGAAGTGCAGATGAATGCAGATCTCGAGATCTGCATTCATCTGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006649.2-1231s1c1
Sequence:CCGGCCATGGAGTTTCTGAAAGTGACTCGAGTCACTTTCAGAAACTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006649.2-2318s1c1
Sequence:CCGGCAGCTGAAGAAATGCTCTGTACTCGAGTACAGAGCATTTCTTCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006649.2-793s1c1
Sequence:CCGGCGTGAAGAAAGGAAAGGCCAACTCGAGTTGGCCTTTCCTTTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006649.2-1714s21c1
Sequence:CCGGGAACCTCCTAACCACACAATCCTCGAGGATTGTGTGGTTAGGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006649.2-363s21c1
Sequence:CCGGCAAAGAAGACAGTGGAGTTACCTCGAGGTAACTCCACTGTCTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006649.2-1399s21c1
Sequence:CCGGGTCTGAATTGAGAGTACTATCCTCGAGGATAGTACTCTCAATTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006649.2-852s21c1
Sequence:CCGGATCCAGCTGCAGCACTAGAAGCTCGAGCTTCTAGTGCTGCAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006649.2-1128s21c1
Sequence:CCGGTGAATGCAGATGGGCCGAATCCTCGAGGATTCGGCCCATCTGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006649
UTP14A MISSION shRNA shRNA Plasmid DNA
UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006649.2-997s1c1
Sequence:CCGGGCAGGAACAGTTGTCTAAGAACTCGAGTTCTTAGACAACTGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006649.2-1118s1c1
Sequence:CCGGGAAGTGCAGATGAATGCAGATCTCGAGATCTGCATTCATCTGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006649.2-1231s1c1
Sequence:CCGGCCATGGAGTTTCTGAAAGTGACTCGAGTCACTTTCAGAAACTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006649.2-2318s1c1
Sequence:CCGGCAGCTGAAGAAATGCTCTGTACTCGAGTACAGAGCATTTCTTCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006649.2-793s1c1
Sequence:CCGGCGTGAAGAAAGGAAAGGCCAACTCGAGTTGGCCTTTCCTTTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006649.2-1714s21c1
Sequence:CCGGGAACCTCCTAACCACACAATCCTCGAGGATTGTGTGGTTAGGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006649.2-363s21c1
Sequence:CCGGCAAAGAAGACAGTGGAGTTACCTCGAGGTAACTCCACTGTCTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006649.2-1399s21c1
Sequence:CCGGGTCTGAATTGAGAGTACTATCCTCGAGGATAGTACTCTCAATTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006649.2-852s21c1
Sequence:CCGGATCCAGCTGCAGCACTAGAAGCTCGAGCTTCTAGTGCTGCAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006649.2-1128s21c1
Sequence:CCGGTGAATGCAGATGGGCCGAATCCTCGAGGATTCGGCCCATCTGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006649
UTP14A MISSION shRNA Lentiviral Transduction Particles
UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006649.2-997s1c1
Sequence:CCGGGCAGGAACAGTTGTCTAAGAACTCGAGTTCTTAGACAACTGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006649.2-1118s1c1
Sequence:CCGGGAAGTGCAGATGAATGCAGATCTCGAGATCTGCATTCATCTGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006649.2-1231s1c1
Sequence:CCGGCCATGGAGTTTCTGAAAGTGACTCGAGTCACTTTCAGAAACTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006649.2-2318s1c1
Sequence:CCGGCAGCTGAAGAAATGCTCTGTACTCGAGTACAGAGCATTTCTTCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006649.2-793s1c1
Sequence:CCGGCGTGAAGAAAGGAAAGGCCAACTCGAGTTGGCCTTTCCTTTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006649.2-1714s21c1
Sequence:CCGGGAACCTCCTAACCACACAATCCTCGAGGATTGTGTGGTTAGGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006649.2-363s21c1
Sequence:CCGGCAAAGAAGACAGTGGAGTTACCTCGAGGTAACTCCACTGTCTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006649.2-1399s21c1
Sequence:CCGGGTCTGAATTGAGAGTACTATCCTCGAGGATAGTACTCTCAATTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006649.2-852s21c1
Sequence:CCGGATCCAGCTGCAGCACTAGAAGCTCGAGCTTCTAGTGCTGCAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006649.2-1128s21c1
Sequence:CCGGTGAATGCAGATGGGCCGAATCCTCGAGGATTCGGCCCATCTGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028276
VALIDATED
UTP14A MISSION shRNA Bacterial Glycerol Stock
UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028276.1-1328s1c1
Sequence:CCGGCACTGGGTAACCAAGAAACAACTCGAGTTGTTTCTTGGTTACCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028276.1-54s1c1
Sequence:CCGGGCAGGATGATCTAATGGATTTCTCGAGAAATCCATTAGATCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028276.1-1362s1c1
Sequence:CCGGCCAGGAGGTATTATCTGAATTCTCGAGAATTCAGATAATACCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028276.1-1078s1c1
Sequence:CCGGCCTGACATAGTGAATGAGGTACTCGAGTACCTCATTCACTATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028276.1-2177s1c1
Sequence:CCGGGCCATATTATCAAACCCATAACTCGAGTTATGGGTTTGATAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028276
VALIDATED
UTP14A MISSION shRNA shRNA Plasmid DNA
UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028276.1-1328s1c1
Sequence:CCGGCACTGGGTAACCAAGAAACAACTCGAGTTGTTTCTTGGTTACCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028276.1-54s1c1
Sequence:CCGGGCAGGATGATCTAATGGATTTCTCGAGAAATCCATTAGATCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028276.1-1362s1c1
Sequence:CCGGCCAGGAGGTATTATCTGAATTCTCGAGAATTCAGATAATACCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028276.1-1078s1c1
Sequence:CCGGCCTGACATAGTGAATGAGGTACTCGAGTACCTCATTCACTATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028276.1-2177s1c1
Sequence:CCGGGCCATATTATCAAACCCATAACTCGAGTTATGGGTTTGATAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028276
VALIDATED
UTP14A MISSION shRNA Lentiviral Transduction Particles
UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028276.1-1328s1c1
Sequence:CCGGCACTGGGTAACCAAGAAACAACTCGAGTTGTTTCTTGGTTACCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028276.1-54s1c1
Sequence:CCGGGCAGGATGATCTAATGGATTTCTCGAGAAATCCATTAGATCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028276.1-1362s1c1
Sequence:CCGGCCAGGAGGTATTATCTGAATTCTCGAGAATTCAGATAATACCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028276.1-1078s1c1
Sequence:CCGGCCTGACATAGTGAATGAGGTACTCGAGTACCTCATTCACTATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028276.1-2177s1c1
Sequence:CCGGGCCATATTATCAAACCCATAACTCGAGTTATGGGTTTGATAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks