EMAIL THIS PAGE TO A FRIEND

UTP14C

UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast)

Synonyms: 2700066J21Rik KIAA0266 UTP14B
Species: Human UTP14C(9724)
UniProtKB ID: Q5TAP6, Q5FWG3, Q92555
Gene ID:
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021645 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021645 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185002 predicted 1163
2 SASI_Hs01_00185003 predicted 1161
3 SASI_Hs01_00185004 predicted 2242
4 SASI_Hs01_00185005 predicted 1534
5 SASI_Hs01_00185006 predicted 1797
6 SASI_Hs01_00185007 predicted 2391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021645
VALIDATED
UTP14C MISSION shRNA Bacterial Glycerol Stock
UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021645.2-3883s1c1
Sequence:CCGGCCATTGCAGATCAGAGCCTTTCTCGAGAAAGGCTCTGATCTGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_021645.2-3624s1c1
Sequence:CCGGCAGCAAAGTAAAGCTCATCTACTCGAGTAGATGAGCTTTACTTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021645.2-4369s1c1
Sequence:CCGGGAATTTGAAGTGACATTCCTACTCGAGTAGGAATGTCACTTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021645.2-4352s1c1
Sequence:CCGGGCAGATTCTCTGATCAGGAATCTCGAGATTCCTGATCAGAGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160704    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021645.2-4227s1c1
Sequence:CCGGCGAAGGAGATATAACTGGCTTCTCGAGAAGCCAGTTATATCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_021645.2-3480s1c1
Sequence:CCGGGCTTCCTCTGTTTAAGTATATCTCGAGATATACTTAAACAGAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_021645.2-3898s1c1
Sequence:CCGGGCCTTTGCTAAATTGCTGAATCTCGAGATTCAGCAATTTAGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021645.2-3521s1c1
Sequence:CCGGGCTATGTTCATTATCCTACTACTCGAGTAGTAGGATAATGAACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021645.2-4273s1c1
Sequence:CCGGGCTGAAACTATCGCTCACATTCTCGAGAATGTGAGCGATAGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021645.2-3748s1c1
Sequence:CCGGGCTGGGAATTGCACTAACATTCTCGAGAATGTTAGTGCAATTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021645
VALIDATED
UTP14C MISSION shRNA shRNA Plasmid DNA
UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021645.2-3883s1c1
Sequence:CCGGCCATTGCAGATCAGAGCCTTTCTCGAGAAAGGCTCTGATCTGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_021645.2-3624s1c1
Sequence:CCGGCAGCAAAGTAAAGCTCATCTACTCGAGTAGATGAGCTTTACTTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021645.2-4369s1c1
Sequence:CCGGGAATTTGAAGTGACATTCCTACTCGAGTAGGAATGTCACTTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021645.2-4352s1c1
Sequence:CCGGGCAGATTCTCTGATCAGGAATCTCGAGATTCCTGATCAGAGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160704    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021645.2-4227s1c1
Sequence:CCGGCGAAGGAGATATAACTGGCTTCTCGAGAAGCCAGTTATATCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_021645.2-3480s1c1
Sequence:CCGGGCTTCCTCTGTTTAAGTATATCTCGAGATATACTTAAACAGAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_021645.2-3898s1c1
Sequence:CCGGGCCTTTGCTAAATTGCTGAATCTCGAGATTCAGCAATTTAGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021645.2-3521s1c1
Sequence:CCGGGCTATGTTCATTATCCTACTACTCGAGTAGTAGGATAATGAACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021645.2-4273s1c1
Sequence:CCGGGCTGAAACTATCGCTCACATTCTCGAGAATGTGAGCGATAGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021645.2-3748s1c1
Sequence:CCGGGCTGGGAATTGCACTAACATTCTCGAGAATGTTAGTGCAATTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021645
VALIDATED
UTP14C MISSION shRNA Lentiviral Transduction Particles
UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021645.2-3883s1c1
Sequence:CCGGCCATTGCAGATCAGAGCCTTTCTCGAGAAAGGCTCTGATCTGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_021645.2-3624s1c1
Sequence:CCGGCAGCAAAGTAAAGCTCATCTACTCGAGTAGATGAGCTTTACTTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021645.2-4369s1c1
Sequence:CCGGGAATTTGAAGTGACATTCCTACTCGAGTAGGAATGTCACTTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021645.2-4352s1c1
Sequence:CCGGGCAGATTCTCTGATCAGGAATCTCGAGATTCCTGATCAGAGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160704    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021645.2-4227s1c1
Sequence:CCGGCGAAGGAGATATAACTGGCTTCTCGAGAAGCCAGTTATATCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_021645.2-3480s1c1
Sequence:CCGGGCTTCCTCTGTTTAAGTATATCTCGAGATATACTTAAACAGAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_021645.2-3898s1c1
Sequence:CCGGGCCTTTGCTAAATTGCTGAATCTCGAGATTCAGCAATTTAGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021645.2-3521s1c1
Sequence:CCGGGCTATGTTCATTATCCTACTACTCGAGTAGTAGGATAATGAACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021645.2-4273s1c1
Sequence:CCGGGCTGAAACTATCGCTCACATTCTCGAGAATGTGAGCGATAGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021645.2-3748s1c1
Sequence:CCGGGCTGGGAATTGCACTAACATTCTCGAGAATGTTAGTGCAATTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks