EMAIL THIS PAGE TO A FRIEND

UTP15

UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)

Synonyms: NET21
UniProtKB ID: Q8TED0, Q6IA60, Q96E08, Q9H9F8
Gene ID:
Mouse(105372) UTP15, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Rat(310019) UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)
Zebrafish(325106) utp15, U3 small nucleolar ribonucleoprotein, homolog
chicken(426152) UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)
domestic cat(101093914) UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)
dog(478098) UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)
cow(526343) UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)
sheep(101113099) UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)
naked mole-rat(101713848) UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)
domestic guinea pig(100736159) UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA044697 Anti-UTP15 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032175 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178918 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178918 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178918 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032175 Rosetta Predictions human pricing
NM_001107647 Rosetta Predictions rat pricing
NM_178918 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193734 predicted 399
2 SASI_Hs02_00359446 predicted 1802
3 SASI_Hs01_00193735 predicted 1122
4 SASI_Hs01_00193736 predicted 290
5 SASI_Hs01_00193737 predicted 228
6 SASI_Hs02_00359447 predicted 1048
7 SASI_Hs02_00359448 predicted 280
8 SASI_Hs01_00193739 predicted 1141
9 SASI_Hs01_00193740 predicted 996
10 SASI_Hs01_00193742 predicted 1309
11 SASI_Hs01_00193733 predicted 573
12 SASI_Hs01_00193738 predicted 1822
13 SASI_Hs01_00193741 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230895 predicted 1353
2 SASI_Rn02_00230896 predicted 734
3 SASI_Rn02_00230897 predicted 1176
4 SASI_Rn02_00230898 predicted 1842
5 SASI_Rn02_00230899 predicted 1492
6 SASI_Rn02_00230900 predicted 363
7 SASI_Rn02_00230901 predicted 925
8 SASI_Rn02_00230902 predicted 1233
9 SASI_Rn02_00230903 predicted 523
10 SASI_Rn02_00230904 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349535 predicted 642
2 SASI_Mm02_00349536 predicted 1193
3 SASI_Mm02_00349537 predicted 1780
4 SASI_Mm02_00349538 predicted 1280
5 SASI_Mm02_00349539 predicted 205
6 SASI_Mm02_00349540 predicted 746
7 SASI_Mm02_00349541 predicted 542
8 SASI_Mm02_00349542 predicted 1047
9 SASI_Mm02_00349543 predicted 666
10 SASI_Mm02_00349544 predicted 265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032175
VALIDATED
UTP15 MISSION shRNA Bacterial Glycerol Stock
UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032175.1-351s1c1
Sequence:CCGGCATGAAGCAACGGGATGACATCTCGAGATGTCATCCCGTTGCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032175.1-829s1c1
Sequence:CCGGGAACACACATCTGATGGATTTCTCGAGAAATCCATCAGATGTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032175.1-211s1c1
Sequence:CCGGGCACATGAAGATGAGACAATACTCGAGTATTGTCTCATCTTCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032175.1-823s1c1
Sequence:CCGGGTGTTGGAACACACATCTGATCTCGAGATCAGATGTGTGTTCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032175.1-399s1c1
Sequence:CCGGCCTAGAATTGTATGACAGGGACTCGAGTCCCTGTCATACAATTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032175.1-476s1c1
Sequence:CCGGCAATAAAGACACCCGAGATTACTCGAGTAATCTCGGGTGTCTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_032175.1-245s1c1
Sequence:CCGGCCAATGGAATACTGAGTGTTACTCGAGTAACACTCAGTATTCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032175.1-818s1c1
Sequence:CCGGCTTCTGTGTTGGAACACACATCTCGAGATGTGTGTTCCAACACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032175.1-68s1c1
Sequence:CCGGCCGTGACATGTTTATGTCTAACTCGAGTTAGACATAAACATGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032175.1-74s1c1
Sequence:CCGGCATGTTTATGTCTAAGCAGCTCTCGAGAGCTGCTTAGACATAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032175.2-2059s21c1
Sequence:CCGGGAGTGTTCTGTATCAACATTTCTCGAGAAATGTTGATACAGAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032175.2-1849s21c1
Sequence:CCGGGAGACTCTCTTTGATACATTACTCGAGTAATGTATCAAAGAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032175
VALIDATED
UTP15 MISSION shRNA shRNA Plasmid DNA
UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032175.1-351s1c1
Sequence:CCGGCATGAAGCAACGGGATGACATCTCGAGATGTCATCCCGTTGCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032175.1-829s1c1
Sequence:CCGGGAACACACATCTGATGGATTTCTCGAGAAATCCATCAGATGTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032175.1-211s1c1
Sequence:CCGGGCACATGAAGATGAGACAATACTCGAGTATTGTCTCATCTTCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032175.1-823s1c1
Sequence:CCGGGTGTTGGAACACACATCTGATCTCGAGATCAGATGTGTGTTCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032175.1-399s1c1
Sequence:CCGGCCTAGAATTGTATGACAGGGACTCGAGTCCCTGTCATACAATTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032175.1-476s1c1
Sequence:CCGGCAATAAAGACACCCGAGATTACTCGAGTAATCTCGGGTGTCTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_032175.1-245s1c1
Sequence:CCGGCCAATGGAATACTGAGTGTTACTCGAGTAACACTCAGTATTCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032175.1-818s1c1
Sequence:CCGGCTTCTGTGTTGGAACACACATCTCGAGATGTGTGTTCCAACACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032175.1-68s1c1
Sequence:CCGGCCGTGACATGTTTATGTCTAACTCGAGTTAGACATAAACATGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032175.1-74s1c1
Sequence:CCGGCATGTTTATGTCTAAGCAGCTCTCGAGAGCTGCTTAGACATAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032175.2-2059s21c1
Sequence:CCGGGAGTGTTCTGTATCAACATTTCTCGAGAAATGTTGATACAGAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032175.2-1849s21c1
Sequence:CCGGGAGACTCTCTTTGATACATTACTCGAGTAATGTATCAAAGAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032175
VALIDATED
UTP15 MISSION shRNA Lentiviral Transduction Particles
UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032175.1-351s1c1
Sequence:CCGGCATGAAGCAACGGGATGACATCTCGAGATGTCATCCCGTTGCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032175.1-829s1c1
Sequence:CCGGGAACACACATCTGATGGATTTCTCGAGAAATCCATCAGATGTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032175.1-211s1c1
Sequence:CCGGGCACATGAAGATGAGACAATACTCGAGTATTGTCTCATCTTCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032175.1-823s1c1
Sequence:CCGGGTGTTGGAACACACATCTGATCTCGAGATCAGATGTGTGTTCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032175.1-399s1c1
Sequence:CCGGCCTAGAATTGTATGACAGGGACTCGAGTCCCTGTCATACAATTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032175.1-476s1c1
Sequence:CCGGCAATAAAGACACCCGAGATTACTCGAGTAATCTCGGGTGTCTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_032175.1-245s1c1
Sequence:CCGGCCAATGGAATACTGAGTGTTACTCGAGTAACACTCAGTATTCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032175.1-818s1c1
Sequence:CCGGCTTCTGTGTTGGAACACACATCTCGAGATGTGTGTTCCAACACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032175.1-68s1c1
Sequence:CCGGCCGTGACATGTTTATGTCTAACTCGAGTTAGACATAAACATGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032175.1-74s1c1
Sequence:CCGGCATGTTTATGTCTAAGCAGCTCTCGAGAGCTGCTTAGACATAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032175.2-2059s21c1
Sequence:CCGGGAGTGTTCTGTATCAACATTTCTCGAGAAATGTTGATACAGAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032175.2-1849s21c1
Sequence:CCGGGAGACTCTCTTTGATACATTACTCGAGTAATGTATCAAAGAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178918
VALIDATED
UTP15 MISSION shRNA Bacterial Glycerol Stock
UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178918.2-1196s1c1
Sequence:CCGGGCCTGCATATCGAACCTTTATCTCGAGATAAAGGTTCGATATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178918.2-780s1c1
Sequence:CCGGGCTCGGACAAATAAGAATGTTCTCGAGAACATTCTTATTTGTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178918.2-3004s1c1
Sequence:CCGGCGCAGGAATTAAAGGTGTGTTCTCGAGAACACACCTTTAATTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178918.2-621s1c1
Sequence:CCGGGCTGATGACTATACTGTTAAACTCGAGTTTAACAGTATAGTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178918.2-318s1c1
Sequence:CCGGGCAGTGTCCAAAGTAGACTTTCTCGAGAAAGTCTACTTTGGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178918
VALIDATED
UTP15 MISSION shRNA shRNA Plasmid DNA
UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178918.2-1196s1c1
Sequence:CCGGGCCTGCATATCGAACCTTTATCTCGAGATAAAGGTTCGATATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178918.2-780s1c1
Sequence:CCGGGCTCGGACAAATAAGAATGTTCTCGAGAACATTCTTATTTGTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178918.2-3004s1c1
Sequence:CCGGCGCAGGAATTAAAGGTGTGTTCTCGAGAACACACCTTTAATTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178918.2-621s1c1
Sequence:CCGGGCTGATGACTATACTGTTAAACTCGAGTTTAACAGTATAGTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178918.2-318s1c1
Sequence:CCGGGCAGTGTCCAAAGTAGACTTTCTCGAGAAAGTCTACTTTGGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178918
VALIDATED
UTP15 MISSION shRNA Lentiviral Transduction Particles
UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178918.2-1196s1c1
Sequence:CCGGGCCTGCATATCGAACCTTTATCTCGAGATAAAGGTTCGATATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178918.2-780s1c1
Sequence:CCGGGCTCGGACAAATAAGAATGTTCTCGAGAACATTCTTATTTGTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178918.2-3004s1c1
Sequence:CCGGCGCAGGAATTAAAGGTGTGTTCTCGAGAACACACCTTTAATTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178918.2-621s1c1
Sequence:CCGGGCTGATGACTATACTGTTAAACTCGAGTTTAACAGTATAGTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178918.2-318s1c1
Sequence:CCGGGCAGTGTCCAAAGTAGACTTTCTCGAGAAAGTCTACTTTGGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks