EMAIL THIS PAGE TO A FRIEND

UTP18

UTP18 small subunit (SSU) processome component homolog (yeast)

Synonyms: CGI-48 WDR50
UniProtKB ID: Q9Y5J1, Q9H4N6
Gene ID:
Mouse(217109) UTP18, small subunit (SSU) processome component, homolog (yeast)
Rat(303456) UTP18, small subunit (SSU) processome component, homolog (yeast)
domestic guinea pig(100713273) UTP18 small subunit (SSU) processome component homolog (yeast)
naked mole-rat(101724606) UTP18 small subunit (SSU) processome component homolog (yeast)
cow(505846) UTP18, small subunit (SSU) processome component, homolog (yeast)
sheep(101115472) UTP18 small subunit (SSU) processome component homolog (yeast)
Zebrafish(767797) UTP18 small subunit (SSU) processome component homolog (yeast)
dog(491088) UTP18 small subunit (SSU) processome component homolog (yeast)
chicken(417388) UTP18 small subunit (SSU) processome component homolog (yeast)
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013375 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013375 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013375 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016001 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016001 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016001 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016001 Rosetta Predictions human pricing
NM_001013375 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029528 predicted 1446
2 SASI_Hs01_00029529 predicted 1496
3 SASI_Hs01_00029530 predicted 999
4 SASI_Hs02_00348680 predicted 1221
5 SASI_Hs01_00029531 predicted 1452
6 SASI_Hs01_00029532 predicted 930
7 SASI_Hs01_00029533 predicted 1365
8 SASI_Hs01_00029535 predicted 490
9 SASI_Hs01_00029536 predicted 1288
10 SASI_Hs01_00029537 predicted 1375
11 SASI_Hs01_00029534 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159160 predicted 1404
2 SASI_Mm01_00159161 predicted 1208
3 SASI_Mm01_00159163 predicted 1142
4 SASI_Mm02_00287199 predicted 733
5 SASI_Mm01_00159164 predicted 1079
6 SASI_Mm01_00159165 predicted 1337
7 SASI_Mm01_00159166 predicted 1246
8 SASI_Mm01_00159167 predicted 1029
9 SASI_Mm01_00159168 predicted 1492
10 SASI_Mm01_00159169 predicted 539
11 SASI_Mm01_00159162 predicted 1527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013375
VALIDATED
UTP18 MISSION shRNA Bacterial Glycerol Stock
UTP18 small subunit (SSU) processome component homolog (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013375.1-1076s21c1
Sequence:CCGGGCTGGGAAGTTAATTCCTGTACTCGAGTACAGGAATTAACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013375.1-1822s21c1
Sequence:CCGGCCAGAAGTTTCCAAGTGTGATCTCGAGATCACACTTGGAAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013375.1-565s21c1
Sequence:CCGGCAATCGGTTTCGGAAAGATATCTCGAGATATCTTTCCGAAACCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013375.1-1730s21c1
Sequence:CCGGGCCCTGATGTATAGGTTGCATCTCGAGATGCAACCTATACATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001013375.1-1730s1c1
Sequence:CCGGGCCCTGATGTATAGGTTGCATCTCGAGATGCAACCTATACATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001013375.1-1822s1c1
Sequence:CCGGCCAGAAGTTTCCAAGTGTGATCTCGAGATCACACTTGGAAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013375.1-1536s1c1
Sequence:CCGGCCTTTAATCCTACCACAGAAACTCGAGTTTCTGTGGTAGGATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001013375.1-565s1c1
Sequence:CCGGCAATCGGTTTCGGAAAGATATCTCGAGATATCTTTCCGAAACCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001013375.1-1076s1c1
Sequence:CCGGGCTGGGAAGTTAATTCCTGTACTCGAGTACAGGAATTAACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013375
VALIDATED
UTP18 MISSION shRNA shRNA Plasmid DNA
UTP18 small subunit (SSU) processome component homolog (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013375.1-1076s21c1
Sequence:CCGGGCTGGGAAGTTAATTCCTGTACTCGAGTACAGGAATTAACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013375.1-1822s21c1
Sequence:CCGGCCAGAAGTTTCCAAGTGTGATCTCGAGATCACACTTGGAAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013375.1-565s21c1
Sequence:CCGGCAATCGGTTTCGGAAAGATATCTCGAGATATCTTTCCGAAACCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013375.1-1730s21c1
Sequence:CCGGGCCCTGATGTATAGGTTGCATCTCGAGATGCAACCTATACATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001013375.1-1730s1c1
Sequence:CCGGGCCCTGATGTATAGGTTGCATCTCGAGATGCAACCTATACATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001013375.1-1822s1c1
Sequence:CCGGCCAGAAGTTTCCAAGTGTGATCTCGAGATCACACTTGGAAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013375.1-1536s1c1
Sequence:CCGGCCTTTAATCCTACCACAGAAACTCGAGTTTCTGTGGTAGGATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001013375.1-565s1c1
Sequence:CCGGCAATCGGTTTCGGAAAGATATCTCGAGATATCTTTCCGAAACCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001013375.1-1076s1c1
Sequence:CCGGGCTGGGAAGTTAATTCCTGTACTCGAGTACAGGAATTAACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013375
VALIDATED
UTP18 MISSION shRNA Lentiviral Transduction Particles
UTP18 small subunit (SSU) processome component homolog (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013375.1-1076s21c1
Sequence:CCGGGCTGGGAAGTTAATTCCTGTACTCGAGTACAGGAATTAACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013375.1-1822s21c1
Sequence:CCGGCCAGAAGTTTCCAAGTGTGATCTCGAGATCACACTTGGAAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013375.1-565s21c1
Sequence:CCGGCAATCGGTTTCGGAAAGATATCTCGAGATATCTTTCCGAAACCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013375.1-1730s21c1
Sequence:CCGGGCCCTGATGTATAGGTTGCATCTCGAGATGCAACCTATACATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001013375.1-1730s1c1
Sequence:CCGGGCCCTGATGTATAGGTTGCATCTCGAGATGCAACCTATACATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001013375.1-1822s1c1
Sequence:CCGGCCAGAAGTTTCCAAGTGTGATCTCGAGATCACACTTGGAAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013375.1-1536s1c1
Sequence:CCGGCCTTTAATCCTACCACAGAAACTCGAGTTTCTGTGGTAGGATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001013375.1-565s1c1
Sequence:CCGGCAATCGGTTTCGGAAAGATATCTCGAGATATCTTTCCGAAACCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001013375.1-1076s1c1
Sequence:CCGGGCTGGGAAGTTAATTCCTGTACTCGAGTACAGGAATTAACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016001
VALIDATED
UTP18 MISSION shRNA Bacterial Glycerol Stock
UTP18 small subunit (SSU) processome component homolog (yeast)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016001.1-1707s1c1
Sequence:CCGGGAGACTATTTGAAGTCCAGTTCTCGAGAACTGGACTTCAAATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016001.1-983s1c1
Sequence:CCGGCAGCAAGGTTCTTTATGTCTACTCGAGTAGACATAAAGAACCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016001.1-840s1c1
Sequence:CCGGGCTGGATTAGATAATGCTGTACTCGAGTACAGCATTATCTAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016001.1-855s1c1
Sequence:CCGGGCTGTATCACTATTTCAGGTTCTCGAGAACCTGAAATAGTGATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016001.1-1693s1c1
Sequence:CCGGCTCAGACTTCTAAAGAGACTACTCGAGTAGTCTCTTTAGAAGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016001.1-1628s1c1
Sequence:CCGGGAGAAGTGGATACTTTGCCTTCTCGAGAAGGCAAAGTATCCACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016001.1-624s1c1
Sequence:CCGGGCAGAGACTACTAAGCGGAAACTCGAGTTTCCGCTTAGTAGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016001.1-1266s1c1
Sequence:CCGGGTGAACTCAAGGAAGTGCCTTCTCGAGAAGGCACTTCCTTGAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016001.1-1056s1c1
Sequence:CCGGGAGAAGATAGTGAGGAGCTTTCTCGAGAAAGCTCCTCACTATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016001
VALIDATED
UTP18 MISSION shRNA shRNA Plasmid DNA
UTP18 small subunit (SSU) processome component homolog (yeast)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016001.1-1707s1c1
Sequence:CCGGGAGACTATTTGAAGTCCAGTTCTCGAGAACTGGACTTCAAATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016001.1-983s1c1
Sequence:CCGGCAGCAAGGTTCTTTATGTCTACTCGAGTAGACATAAAGAACCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016001.1-840s1c1
Sequence:CCGGGCTGGATTAGATAATGCTGTACTCGAGTACAGCATTATCTAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016001.1-855s1c1
Sequence:CCGGGCTGTATCACTATTTCAGGTTCTCGAGAACCTGAAATAGTGATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016001.1-1693s1c1
Sequence:CCGGCTCAGACTTCTAAAGAGACTACTCGAGTAGTCTCTTTAGAAGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016001.1-1628s1c1
Sequence:CCGGGAGAAGTGGATACTTTGCCTTCTCGAGAAGGCAAAGTATCCACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016001.1-624s1c1
Sequence:CCGGGCAGAGACTACTAAGCGGAAACTCGAGTTTCCGCTTAGTAGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016001.1-1266s1c1
Sequence:CCGGGTGAACTCAAGGAAGTGCCTTCTCGAGAAGGCACTTCCTTGAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016001.1-1056s1c1
Sequence:CCGGGAGAAGATAGTGAGGAGCTTTCTCGAGAAAGCTCCTCACTATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016001
VALIDATED
UTP18 MISSION shRNA Lentiviral Transduction Particles
UTP18 small subunit (SSU) processome component homolog (yeast)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016001.1-1707s1c1
Sequence:CCGGGAGACTATTTGAAGTCCAGTTCTCGAGAACTGGACTTCAAATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016001.1-983s1c1
Sequence:CCGGCAGCAAGGTTCTTTATGTCTACTCGAGTAGACATAAAGAACCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016001.1-840s1c1
Sequence:CCGGGCTGGATTAGATAATGCTGTACTCGAGTACAGCATTATCTAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016001.1-855s1c1
Sequence:CCGGGCTGTATCACTATTTCAGGTTCTCGAGAACCTGAAATAGTGATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016001.1-1693s1c1
Sequence:CCGGCTCAGACTTCTAAAGAGACTACTCGAGTAGTCTCTTTAGAAGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016001.1-1628s1c1
Sequence:CCGGGAGAAGTGGATACTTTGCCTTCTCGAGAAGGCAAAGTATCCACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016001.1-624s1c1
Sequence:CCGGGCAGAGACTACTAAGCGGAAACTCGAGTTTCCGCTTAGTAGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016001.1-1266s1c1
Sequence:CCGGGTGAACTCAAGGAAGTGCCTTCTCGAGAAGGCACTTCCTTGAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016001.1-1056s1c1
Sequence:CCGGGAGAAGATAGTGAGGAGCTTTCTCGAGAAAGCTCCTCACTATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks