EMAIL THIS PAGE TO A FRIEND

UTP20

UTP20, small subunit (SSU) processome component, homolog (yeast)

Synonyms: DRIM
UniProtKB ID: O75691, Q9H3H4
Gene ID:
Human(27340) Summary: UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]
Mouse(70683) UTP20, small subunit (SSU) processome component, homolog (yeast)
Rat(314713) UTP20, small subunit (SSU) processome component, homolog (yeast)
chicken(417933) UTP20, small subunit (SSU) processome component, homolog (yeast)
dog(475441) UTP20, small subunit (SSU) processome component, homolog (yeast)
domestic cat(101098727) UTP20, small subunit (SSU) processome component, homolog (yeast)
Horse(100052925) UTP20, small subunit (SSU) processome component, homolog (yeast)
cow(510487) UTP20, small subunit (SSU) processome component, homolog (yeast)
sheep(101107084) UTP20, small subunit (SSU) processome component, homolog (yeast)
naked mole-rat(101712346) UTP20, small subunit (SSU) processome component, homolog (yeast)
Domestic Rabbit(100340059) UTP20, small subunit (SSU) processome component, homolog (yeast)
domestic guinea pig(100715345) UTP20, small subunit (SSU) processome component, homolog (yeast)
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA049341 Anti-UTP20 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014503 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175158 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175158 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175158 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014503 Rosetta Predictions human pricing
XM_235023 Rosetta Predictions rat pricing
XR_009342 Rosetta Predictions rat pricing
XM_125867 Rosetta Predictions mouse pricing
XM_901758 Rosetta Predictions mouse pricing
XM_901765 Rosetta Predictions mouse pricing
XM_917289 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162937 predicted 8111
2 SASI_Hs01_00162939 predicted 5345
3 SASI_Hs01_00162941 predicted 3217
4 SASI_Hs02_00345757 predicted 4571
5 SASI_Hs01_00162943 predicted 4563
6 SASI_Hs02_00345758 predicted 6128
7 SASI_Hs02_00345759 predicted 3526
8 SASI_Hs02_00345760 predicted 2307
9 SASI_Hs02_00345761 predicted 1410
10 SASI_Hs02_00345762 predicted 2428
11 SASI_Hs01_00162936 predicted 5257
12 SASI_Hs01_00162938 predicted 7855
13 SASI_Hs01_00162940 predicted 5667
14 SASI_Hs01_00162942 predicted 3834
15 SASI_Hs01_00162944 predicted 3430
16 SASI_Hs01_00162945 predicted 1722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388911 predicted 3915
2 SASI_Rn02_00388912 predicted 7775
3 SASI_Rn02_00388913 predicted 3043
4 SASI_Rn02_00388914 predicted 7748
5 SASI_Rn02_00388915 predicted 3008
6 SASI_Rn02_00388916 predicted 5709
7 SASI_Rn02_00388917 predicted 1213
8 SASI_Rn02_00388918 predicted 2303
9 SASI_Rn02_00388919 predicted 4012
10 SASI_Rn02_00388920 predicted 1601
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00140582 predicted 3917
2 SASI_Rn01_00140584 predicted 3047
3 SASI_Rn01_00140586 predicted 3011
4 SASI_Rn01_00140587 predicted 5707
5 SASI_Rn02_00419431 predicted 810
6 SASI_Rn01_00140588 predicted 1212
7 SASI_Rn02_00419432 predicted 2305
8 SASI_Rn01_00140589 predicted 4011
9 SASI_Rn02_00419433 predicted 1604
10 SASI_Rn02_00419434 predicted 2239
11 SASI_Rn01_00140583 predicted 7782
12 SASI_Rn01_00140585 predicted 7753
13 SASI_Rn01_00140590 predicted 5334
14 SASI_Rn01_00140591 predicted 3124
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210813 predicted 6993
2 SASI_Mm01_00210814 predicted 7510
3 SASI_Mm01_00210815 predicted 7499
4 SASI_Mm01_00210816 predicted 6398
5 SASI_Mm01_00210817 predicted 7496
6 SASI_Mm01_00210818 predicted 7747
7 SASI_Mm01_00210819 predicted 8597
8 SASI_Mm01_00210820 predicted 7073
9 SASI_Mm01_00210821 predicted 7494
10 SASI_Mm01_00210822 predicted 7729
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248557 predicted 3242
2 SASI_Mm01_00248558 predicted 3759
3 SASI_Mm01_00248559 predicted 3754
4 SASI_Mm01_00248560 predicted 2643
5 SASI_Mm01_00248561 predicted 3751
6 SASI_Mm01_00248562 predicted 4004
7 SASI_Mm01_00248563 predicted 4852
8 SASI_Mm01_00248564 predicted 3322
9 SASI_Mm01_00248565 predicted 3751
10 SASI_Mm01_00248566 predicted 3976
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257767 predicted 1234
2 SASI_Mm01_00257768 predicted 1745
3 SASI_Mm01_00257769 predicted 1738
4 SASI_Mm01_00257770 predicted 631
5 SASI_Mm01_00257771 predicted 1729
6 SASI_Mm01_00257772 predicted 1994
7 SASI_Mm01_00257773 predicted 2842
8 SASI_Mm01_00257774 predicted 1317
9 SASI_Mm01_00257775 predicted 1739
10 SASI_Mm01_00257776 predicted 1967
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917289 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441035 predicted 5675
2 SASI_Mm02_00441036 predicted 1923
3 SASI_Mm02_00441037 predicted 2383
4 SASI_Mm02_00441038 predicted 5164
5 SASI_Mm02_00441039 predicted 2431
6 SASI_Mm02_00441040 predicted 6160
7 SASI_Mm02_00441041 predicted 298
8 SASI_Mm02_00441042 predicted 4243
9 SASI_Mm02_00441043 predicted 3613
10 SASI_Mm02_00441044 predicted 4482
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014503
VALIDATED
UTP20 MISSION shRNA Bacterial Glycerol Stock
UTP20, small subunit (SSU) processome component, homolog (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014503.1-5844s1c1
Sequence:CCGGGCTGACTTTCACCGTTCACATCTCGAGATGTGAACGGTGAAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121824    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014503.1-8524s1c1
Sequence:CCGGGCATGAACTTTCTGGAATATTCTCGAGAATATTCCAGAAAGTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014503.1-2039s1c1
Sequence:CCGGCCAAGTTACAAGCAAACATTTCTCGAGAAATGTTTGCTTGTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014503.1-4660s1c1
Sequence:CCGGGCCTTGAATGTCACAGAGAAACTCGAGTTTCTCTGTGACATTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014503.1-2304s1c1
Sequence:CCGGGCTTCGTTATTTGTTAGGCATCTCGAGATGCCTAACAAATAACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014503.1-402s1c1
Sequence:CCGGCGAGATAGTTCAGAGTTTGAACTCGAGTTCAAACTCTGAACTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014503.1-6160s1c1
Sequence:CCGGCGAATCACAGTGGGATTAATTCTCGAGAATTAATCCCACTGTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014503.2-3494s21c1
Sequence:CCGGGCGCATACCTGCCGAAGATTTCTCGAGAAATCTTCGGCAGGTATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014503.2-3431s21c1
Sequence:CCGGGTCGTCAGCACGGTATCTTAACTCGAGTTAAGATACCGTGCTGACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014503.2-1721s21c1
Sequence:CCGGTCGTGGTGTTACCTCATATTACTCGAGTAATATGAGGTAACACCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014503
VALIDATED
UTP20 MISSION shRNA shRNA Plasmid DNA
UTP20, small subunit (SSU) processome component, homolog (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014503.1-5844s1c1
Sequence:CCGGGCTGACTTTCACCGTTCACATCTCGAGATGTGAACGGTGAAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121824    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014503.1-8524s1c1
Sequence:CCGGGCATGAACTTTCTGGAATATTCTCGAGAATATTCCAGAAAGTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014503.1-2039s1c1
Sequence:CCGGCCAAGTTACAAGCAAACATTTCTCGAGAAATGTTTGCTTGTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014503.1-4660s1c1
Sequence:CCGGGCCTTGAATGTCACAGAGAAACTCGAGTTTCTCTGTGACATTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014503.1-2304s1c1
Sequence:CCGGGCTTCGTTATTTGTTAGGCATCTCGAGATGCCTAACAAATAACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014503.1-402s1c1
Sequence:CCGGCGAGATAGTTCAGAGTTTGAACTCGAGTTCAAACTCTGAACTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014503.1-6160s1c1
Sequence:CCGGCGAATCACAGTGGGATTAATTCTCGAGAATTAATCCCACTGTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014503.2-3494s21c1
Sequence:CCGGGCGCATACCTGCCGAAGATTTCTCGAGAAATCTTCGGCAGGTATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014503.2-3431s21c1
Sequence:CCGGGTCGTCAGCACGGTATCTTAACTCGAGTTAAGATACCGTGCTGACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014503.2-1721s21c1
Sequence:CCGGTCGTGGTGTTACCTCATATTACTCGAGTAATATGAGGTAACACCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014503
VALIDATED
UTP20 MISSION shRNA Lentiviral Transduction Particles
UTP20, small subunit (SSU) processome component, homolog (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014503.1-5844s1c1
Sequence:CCGGGCTGACTTTCACCGTTCACATCTCGAGATGTGAACGGTGAAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121824    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014503.1-8524s1c1
Sequence:CCGGGCATGAACTTTCTGGAATATTCTCGAGAATATTCCAGAAAGTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014503.1-2039s1c1
Sequence:CCGGCCAAGTTACAAGCAAACATTTCTCGAGAAATGTTTGCTTGTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014503.1-4660s1c1
Sequence:CCGGGCCTTGAATGTCACAGAGAAACTCGAGTTTCTCTGTGACATTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014503.1-2304s1c1
Sequence:CCGGGCTTCGTTATTTGTTAGGCATCTCGAGATGCCTAACAAATAACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014503.1-402s1c1
Sequence:CCGGCGAGATAGTTCAGAGTTTGAACTCGAGTTCAAACTCTGAACTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014503.1-6160s1c1
Sequence:CCGGCGAATCACAGTGGGATTAATTCTCGAGAATTAATCCCACTGTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014503.2-3494s21c1
Sequence:CCGGGCGCATACCTGCCGAAGATTTCTCGAGAAATCTTCGGCAGGTATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014503.2-3431s21c1
Sequence:CCGGGTCGTCAGCACGGTATCTTAACTCGAGTTAAGATACCGTGCTGACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014503.2-1721s21c1
Sequence:CCGGTCGTGGTGTTACCTCATATTACTCGAGTAATATGAGGTAACACCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175158
VALIDATED
UTP20 MISSION shRNA Bacterial Glycerol Stock
UTP20, small subunit (SSU) processome component, homolog (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175158.3-611s21c1
Sequence:CCGGCACCTCGCTCTCGTATCTTTACTCGAGTAAAGATACGAGAGCGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175158.3-2943s21c1
Sequence:CCGGTCAAACCCACGGGCCTTATATCTCGAGATATAAGGCCCGTGGGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175158.3-344s21c1
Sequence:CCGGTACGGAACATTTCGGGAAATTCTCGAGAATTTCCCGAAATGTTCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175158.3-8644s21c1
Sequence:CCGGTGGTGGCTTAACACCTGTAATCTCGAGATTACAGGTGTTAAGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175158.3-6169s21c1
Sequence:CCGGACGAAACCTTACGCCGAATTACTCGAGTAATTCGGCGTAAGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175158
VALIDATED
UTP20 MISSION shRNA shRNA Plasmid DNA
UTP20, small subunit (SSU) processome component, homolog (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175158.3-611s21c1
Sequence:CCGGCACCTCGCTCTCGTATCTTTACTCGAGTAAAGATACGAGAGCGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175158.3-2943s21c1
Sequence:CCGGTCAAACCCACGGGCCTTATATCTCGAGATATAAGGCCCGTGGGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175158.3-344s21c1
Sequence:CCGGTACGGAACATTTCGGGAAATTCTCGAGAATTTCCCGAAATGTTCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175158.3-8644s21c1
Sequence:CCGGTGGTGGCTTAACACCTGTAATCTCGAGATTACAGGTGTTAAGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175158.3-6169s21c1
Sequence:CCGGACGAAACCTTACGCCGAATTACTCGAGTAATTCGGCGTAAGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175158
VALIDATED
UTP20 MISSION shRNA Lentiviral Transduction Particles
UTP20, small subunit (SSU) processome component, homolog (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175158.3-611s21c1
Sequence:CCGGCACCTCGCTCTCGTATCTTTACTCGAGTAAAGATACGAGAGCGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175158.3-2943s21c1
Sequence:CCGGTCAAACCCACGGGCCTTATATCTCGAGATATAAGGCCCGTGGGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175158.3-344s21c1
Sequence:CCGGTACGGAACATTTCGGGAAATTCTCGAGAATTTCCCGAAATGTTCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175158.3-8644s21c1
Sequence:CCGGTGGTGGCTTAACACCTGTAATCTCGAGATTACAGGTGTTAAGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175158.3-6169s21c1
Sequence:CCGGACGAAACCTTACGCCGAATTACTCGAGTAATTCGGCGTAAGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks