EMAIL THIS PAGE TO A FRIEND

UTP23

UTP23, small subunit (SSU) processome component, homolog (yeast)

Synonyms: C8orf53
UniProtKB ID: Q9BRU9, B2RE25, Q96NJ8
Gene ID:
Mouse(78581) UTP23, small subunit (SSU) processome component, homolog (yeast)
Rat(299900) UTP23, small subunit (SSU) processome component, homolog (yeast)
domestic guinea pig(100723609) UTP23, small subunit (SSU) processome component, homolog (yeast)
naked mole-rat(101704209) UTP23, small subunit (SSU) processome component, homolog (yeast)
cow(534858) UTP23, small subunit (SSU) processome component, homolog (yeast)
sheep(101115377) UTP23, small subunit (SSU) processome component, homolog (yeast)
Zebrafish(550514) UTP23, small subunit (SSU) processome component, homolog (yeast)
domestic cat(101095469) UTP23, small subunit (SSU) processome component, homolog (yeast)
dog(482020) UTP23, small subunit (SSU) processome component, homolog (yeast)
chicken(420287) UTP23, small subunit (SSU) processome component, homolog (yeast)
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030132 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030132 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030132 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032334 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032334 Rosetta Predictions human pricing
NM_001126266 Rosetta Predictions rat pricing
NM_030132 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186879 predicted 353
2 SASI_Hs01_00186881 predicted 426
3 SASI_Hs02_00359712 predicted 392
4 SASI_Hs01_00186882 predicted 402
5 SASI_Hs01_00186883 predicted 497
6 SASI_Hs02_00359713 predicted 421
7 SASI_Hs02_00359714 predicted 430
8 SASI_Hs01_00186886 predicted 446
9 SASI_Hs02_00359715 predicted 272
10 SASI_Hs02_00359716 predicted 282
11 SASI_Hs01_00186877 predicted 391
12 SASI_Hs01_00186878 predicted 310
13 SASI_Hs01_00186880 predicted 537
14 SASI_Hs01_00186884 predicted 466
15 SASI_Hs01_00186885 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253033 predicted 256
2 SASI_Rn02_00253034 predicted 283
3 SASI_Rn02_00253035 predicted 329
4 SASI_Rn02_00253036 predicted 303
5 SASI_Rn02_00253037 predicted 378
6 SASI_Rn02_00253038 predicted 402
7 SASI_Rn02_00253039 predicted 266
8 SASI_Rn02_00253040 predicted 342
9 SASI_Rn02_00253041 predicted 431
10 SASI_Rn02_00253042 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030132 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121218 predicted 301
2 SASI_Mm01_00121219 predicted 415
3 SASI_Mm01_00121220 predicted 413
4 SASI_Mm01_00121221 predicted 373
5 SASI_Mm01_00121223 predicted 526
6 SASI_Mm02_00336530 predicted 275
7 SASI_Mm02_00336531 predicted 500
8 SASI_Mm02_00336532 predicted 420
9 SASI_Mm02_00336533 predicted 308
10 SASI_Mm02_00336534 predicted 284
11 SASI_Mm01_00121222 predicted 804
12 SASI_Mm01_00121224 predicted 432
13 SASI_Mm01_00121225 predicted 716
14 SASI_Mm01_00121226 predicted 722
15 SASI_Mm01_00121227 predicted 724
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030132
VALIDATED
UTP23 MISSION shRNA Bacterial Glycerol Stock
UTP23, small subunit (SSU) processome component, homolog (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030132.4-194s21c1
Sequence:CCGGACCACGAGATGTGTGTTAAAGCTCGAGCTTTAACACACATCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030132.4-201s1c1
Sequence:CCGGGATGTGTGTTAAAGGAGTTAGCTCGAGCTAACTCCTTTAACACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030132.4-369s21c1
Sequence:CCGGCCACACAGGATCAGAACTTATCTCGAGATAAGTTCTGATCCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030132.4-224s21c1
Sequence:CCGGACACTGGGAAAGGAATTATATCTCGAGATATAATTCCTTTCCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030132.4-510s21c1
Sequence:CCGGTGGTCTCAGTGCACGAGAAACCTCGAGGTTTCTCGTGCACTGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030132.4-1169s21c1
Sequence:CCGGCTATCACTCTCTACCATTATTCTCGAGAATAATGGTAGAGAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192920    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030132.2-1168s1c1
Sequence:CCGGGCATGAAGTGTCTTTCTCTATCTCGAGATAGAGAAAGACACTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030132.2-391s1c1
Sequence:CCGGGATCAGAACTTATCTGTGAAACTCGAGTTTCACAGATAAGTTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030132.2-275s1c1
Sequence:CCGGCACAGAAATGCCAGGTTCGAACTCGAGTTCGAACCTGGCATTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030132
VALIDATED
UTP23 MISSION shRNA shRNA Plasmid DNA
UTP23, small subunit (SSU) processome component, homolog (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030132.4-194s21c1
Sequence:CCGGACCACGAGATGTGTGTTAAAGCTCGAGCTTTAACACACATCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030132.4-201s1c1
Sequence:CCGGGATGTGTGTTAAAGGAGTTAGCTCGAGCTAACTCCTTTAACACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030132.4-369s21c1
Sequence:CCGGCCACACAGGATCAGAACTTATCTCGAGATAAGTTCTGATCCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030132.4-224s21c1
Sequence:CCGGACACTGGGAAAGGAATTATATCTCGAGATATAATTCCTTTCCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030132.4-510s21c1
Sequence:CCGGTGGTCTCAGTGCACGAGAAACCTCGAGGTTTCTCGTGCACTGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030132.4-1169s21c1
Sequence:CCGGCTATCACTCTCTACCATTATTCTCGAGAATAATGGTAGAGAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192920    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030132.2-1168s1c1
Sequence:CCGGGCATGAAGTGTCTTTCTCTATCTCGAGATAGAGAAAGACACTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030132.2-391s1c1
Sequence:CCGGGATCAGAACTTATCTGTGAAACTCGAGTTTCACAGATAAGTTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030132.2-275s1c1
Sequence:CCGGCACAGAAATGCCAGGTTCGAACTCGAGTTCGAACCTGGCATTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030132
VALIDATED
UTP23 MISSION shRNA Lentiviral Transduction Particles
UTP23, small subunit (SSU) processome component, homolog (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030132.4-194s21c1
Sequence:CCGGACCACGAGATGTGTGTTAAAGCTCGAGCTTTAACACACATCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030132.4-201s1c1
Sequence:CCGGGATGTGTGTTAAAGGAGTTAGCTCGAGCTAACTCCTTTAACACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030132.4-369s21c1
Sequence:CCGGCCACACAGGATCAGAACTTATCTCGAGATAAGTTCTGATCCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030132.4-224s21c1
Sequence:CCGGACACTGGGAAAGGAATTATATCTCGAGATATAATTCCTTTCCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030132.4-510s21c1
Sequence:CCGGTGGTCTCAGTGCACGAGAAACCTCGAGGTTTCTCGTGCACTGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030132.4-1169s21c1
Sequence:CCGGCTATCACTCTCTACCATTATTCTCGAGAATAATGGTAGAGAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192920    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030132.2-1168s1c1
Sequence:CCGGGCATGAAGTGTCTTTCTCTATCTCGAGATAGAGAAAGACACTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030132.2-391s1c1
Sequence:CCGGGATCAGAACTTATCTGTGAAACTCGAGTTTCACAGATAAGTTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030132.2-275s1c1
Sequence:CCGGCACAGAAATGCCAGGTTCGAACTCGAGTTCGAACCTGGCATTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032334
VALIDATED
UTP23 MISSION shRNA Bacterial Glycerol Stock
UTP23, small subunit (SSU) processome component, homolog (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032334.1-137s21c1
Sequence:CCGGTCTTGGCTTCTTCCGCAACAACTCGAGTTGTTGCGGAAGAAGCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032334.1-618s21c1
Sequence:CCGGGAAAGTATCAAACATCTCAAACTCGAGTTTGAGATGTTTGATACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032334.1-499s1c1
Sequence:CCGGCTGGAGTTCCTCTCATGTTTACTCGAGTAAACATGAGAGGAACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032334.1-430s1c1
Sequence:CCGGAGGGAAATCCTCATCATTATTCTCGAGAATAATGATGAGGATTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032334.1-794s21c1
Sequence:CCGGTCGGAACAGATCTAACCCAAACTCGAGTTTGGGTTAGATCTGTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032334.1-741s21c1
Sequence:CCGGGCACCGGACACACAATCATCTCTCGAGAGATGATTGTGTGTCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032334.1-389s21c1
Sequence:CCGGTGCAGTGAGTGGATCAGAATGCTCGAGCATTCTGATCCACTCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032334.1-305s1c1
Sequence:CCGGGCTAGAAACATTGGGAAAGGACTCGAGTCCTTTCCCAATGTTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032334.1-711s1c1
Sequence:CCGGCCTCTTAGTTGTTTGAAGAAACTCGAGTTTCTTCAAACAACTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032334.1-465s1c1
Sequence:CCGGGATCAGAATTTGTCTGTGAAACTCGAGTTTCACAGACAAATTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032334
VALIDATED
UTP23 MISSION shRNA shRNA Plasmid DNA
UTP23, small subunit (SSU) processome component, homolog (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032334.1-137s21c1
Sequence:CCGGTCTTGGCTTCTTCCGCAACAACTCGAGTTGTTGCGGAAGAAGCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032334.1-618s21c1
Sequence:CCGGGAAAGTATCAAACATCTCAAACTCGAGTTTGAGATGTTTGATACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032334.1-499s1c1
Sequence:CCGGCTGGAGTTCCTCTCATGTTTACTCGAGTAAACATGAGAGGAACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032334.1-430s1c1
Sequence:CCGGAGGGAAATCCTCATCATTATTCTCGAGAATAATGATGAGGATTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032334.1-794s21c1
Sequence:CCGGTCGGAACAGATCTAACCCAAACTCGAGTTTGGGTTAGATCTGTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032334.1-741s21c1
Sequence:CCGGGCACCGGACACACAATCATCTCTCGAGAGATGATTGTGTGTCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032334.1-389s21c1
Sequence:CCGGTGCAGTGAGTGGATCAGAATGCTCGAGCATTCTGATCCACTCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032334.1-305s1c1
Sequence:CCGGGCTAGAAACATTGGGAAAGGACTCGAGTCCTTTCCCAATGTTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032334.1-711s1c1
Sequence:CCGGCCTCTTAGTTGTTTGAAGAAACTCGAGTTTCTTCAAACAACTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032334.1-465s1c1
Sequence:CCGGGATCAGAATTTGTCTGTGAAACTCGAGTTTCACAGACAAATTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032334
VALIDATED
UTP23 MISSION shRNA Lentiviral Transduction Particles
UTP23, small subunit (SSU) processome component, homolog (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032334.1-137s21c1
Sequence:CCGGTCTTGGCTTCTTCCGCAACAACTCGAGTTGTTGCGGAAGAAGCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032334.1-618s21c1
Sequence:CCGGGAAAGTATCAAACATCTCAAACTCGAGTTTGAGATGTTTGATACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032334.1-499s1c1
Sequence:CCGGCTGGAGTTCCTCTCATGTTTACTCGAGTAAACATGAGAGGAACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032334.1-430s1c1
Sequence:CCGGAGGGAAATCCTCATCATTATTCTCGAGAATAATGATGAGGATTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032334.1-794s21c1
Sequence:CCGGTCGGAACAGATCTAACCCAAACTCGAGTTTGGGTTAGATCTGTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032334.1-741s21c1
Sequence:CCGGGCACCGGACACACAATCATCTCTCGAGAGATGATTGTGTGTCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032334.1-389s21c1
Sequence:CCGGTGCAGTGAGTGGATCAGAATGCTCGAGCATTCTGATCCACTCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032334.1-305s1c1
Sequence:CCGGGCTAGAAACATTGGGAAAGGACTCGAGTCCTTTCCCAATGTTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032334.1-711s1c1
Sequence:CCGGCCTCTTAGTTGTTTGAAGAAACTCGAGTTTCTTCAAACAACTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032334.1-465s1c1
Sequence:CCGGGATCAGAATTTGTCTGTGAAACTCGAGTTTCACAGACAAATTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks