EMAIL THIS PAGE TO A FRIEND

UTP3

UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)

Synonyms: CRL1 CRLZ1 SAS10
UniProtKB ID: Q9NQZ2, Q6FI82
Gene ID:
Mouse(65961) UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)
Rat(305258) UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)
Zebrafish(447856) UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)
domestic cat(101085037) UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)
dog(475167) UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)
chicken(422644) UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)
cow(521106) UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)
sheep(101122028) UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)
naked mole-rat(101718343) UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)
domestic guinea pig(100716155) UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023054 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023054 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023054 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020368 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020368 Rosetta Predictions human pricing
NM_001012036 Rosetta Predictions rat pricing
XM_573570 Rosetta Predictions rat pricing
NM_023054 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048250 predicted 1386
2 SASI_Hs02_00353320 predicted 1057
3 SASI_Hs01_00048251 predicted 1373
4 SASI_Hs01_00048252 predicted 866
5 SASI_Hs02_00353321 predicted 1193
6 SASI_Hs01_00048253 predicted 1061
7 SASI_Hs01_00048255 predicted 1343
8 SASI_Hs01_00048256 predicted 1201
9 SASI_Hs01_00048257 predicted 1290
10 SASI_Hs01_00048258 predicted 1236
11 SASI_Hs01_00048254 predicted 1426
12 SASI_Hs01_00048259 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074276 predicted 262
2 SASI_Rn01_00074277 predicted 420
3 SASI_Rn01_00074278 predicted 963
4 SASI_Rn02_00200133 predicted 1279
5 SASI_Rn01_00074279 predicted 839
6 SASI_Rn01_00074280 predicted 666
7 SASI_Rn01_00074281 predicted 1247
8 SASI_Rn01_00074282 predicted 866
9 SASI_Rn01_00074283 predicted 663
10 SASI_Rn01_00074284 predicted 1267
11 SASI_Rn01_00074285 predicted 1409
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573570 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168255 predicted 268
2 SASI_Rn01_00168256 predicted 424
3 SASI_Rn01_00168257 predicted 973
4 SASI_Rn01_00168258 predicted 844
5 SASI_Rn01_00168259 predicted 664
6 SASI_Rn01_00168260 predicted 1253
7 SASI_Rn01_00168261 predicted 874
8 SASI_Rn01_00168262 predicted 667
9 SASI_Rn01_00168263 predicted 1281
10 SASI_Rn01_00168264 predicted 1418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132271 predicted 1338
2 SASI_Mm01_00132272 predicted 801
3 SASI_Mm01_00132279 predicted 861
4 SASI_Mm02_00326754 predicted 1226
5 SASI_Mm02_00326755 predicted 617
6 SASI_Mm02_00326756 predicted 1021
7 SASI_Mm01_00132273 predicted 1069
8 SASI_Mm01_00132274 predicted 1229
9 SASI_Mm01_00132275 predicted 919
10 SASI_Mm02_00326757 predicted 1367
11 SASI_Mm01_00132276 predicted 1325
12 SASI_Mm01_00132277 predicted 1238
13 SASI_Mm01_00132278 predicted 734
14 SASI_Mm01_00132280 predicted 269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023054
VALIDATED
UTP3 MISSION shRNA Bacterial Glycerol Stock
UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023054.1-1377s1c1
Sequence:CCGGCCCAGGAGAAAGAAGATTGATCTCGAGATCAATCTTCTTTCTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023054.1-1233s1c1
Sequence:CCGGGCTCTCAAGTACTATAAGGAACTCGAGTTCCTTATAGTACTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023054.1-530s1c1
Sequence:CCGGGCTTTATTACGATACGGACTACTCGAGTAGTCCGTATCGTAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023054.1-744s1c1
Sequence:CCGGGATTTGGCTAAAGTCTCGGTACTCGAGTACCGAGACTTTAGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023054.1-279s1c1
Sequence:CCGGCAGGTAGATGAGTTCCATGAACTCGAGTTCATGGAACTCATCTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023054.1-944s1c1
Sequence:CCGGCTTGAACTATTGCGCCAACATCTCGAGATGTTGGCGCAATAGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023054.1-1002s1c1
Sequence:CCGGGCACATGGACATCCTGTTATACTCGAGTATAACAGGATGTCCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023054.1-1228s21c1
Sequence:CCGGGGGCTGCTCTCAAGTACTATACTCGAGTATAGTACTTGAGAGCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023054.1-946s21c1
Sequence:CCGGTGAACTATTGCGCCAACATTACTCGAGTAATGTTGGCGCAATAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023054.1-746s21c1
Sequence:CCGGTTTGGCTAAAGTCTCGGTAAACTCGAGTTTACCGAGACTTTAGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023054.1-914s21c1
Sequence:CCGGCGAATACCTGAAGACTAAGTACTCGAGTACTTAGTCTTCAGGTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023054.1-1336s21c1
Sequence:CCGGGAGCCATTACCTACCAGATTGCTCGAGCAATCTGGTAGGTAATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023054
VALIDATED
UTP3 MISSION shRNA shRNA Plasmid DNA
UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023054.1-1377s1c1
Sequence:CCGGCCCAGGAGAAAGAAGATTGATCTCGAGATCAATCTTCTTTCTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023054.1-1233s1c1
Sequence:CCGGGCTCTCAAGTACTATAAGGAACTCGAGTTCCTTATAGTACTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023054.1-530s1c1
Sequence:CCGGGCTTTATTACGATACGGACTACTCGAGTAGTCCGTATCGTAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023054.1-744s1c1
Sequence:CCGGGATTTGGCTAAAGTCTCGGTACTCGAGTACCGAGACTTTAGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023054.1-279s1c1
Sequence:CCGGCAGGTAGATGAGTTCCATGAACTCGAGTTCATGGAACTCATCTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023054.1-944s1c1
Sequence:CCGGCTTGAACTATTGCGCCAACATCTCGAGATGTTGGCGCAATAGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023054.1-1002s1c1
Sequence:CCGGGCACATGGACATCCTGTTATACTCGAGTATAACAGGATGTCCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023054.1-1228s21c1
Sequence:CCGGGGGCTGCTCTCAAGTACTATACTCGAGTATAGTACTTGAGAGCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023054.1-946s21c1
Sequence:CCGGTGAACTATTGCGCCAACATTACTCGAGTAATGTTGGCGCAATAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023054.1-746s21c1
Sequence:CCGGTTTGGCTAAAGTCTCGGTAAACTCGAGTTTACCGAGACTTTAGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023054.1-914s21c1
Sequence:CCGGCGAATACCTGAAGACTAAGTACTCGAGTACTTAGTCTTCAGGTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023054.1-1336s21c1
Sequence:CCGGGAGCCATTACCTACCAGATTGCTCGAGCAATCTGGTAGGTAATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023054
VALIDATED
UTP3 MISSION shRNA Lentiviral Transduction Particles
UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023054.1-1377s1c1
Sequence:CCGGCCCAGGAGAAAGAAGATTGATCTCGAGATCAATCTTCTTTCTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023054.1-1233s1c1
Sequence:CCGGGCTCTCAAGTACTATAAGGAACTCGAGTTCCTTATAGTACTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023054.1-530s1c1
Sequence:CCGGGCTTTATTACGATACGGACTACTCGAGTAGTCCGTATCGTAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023054.1-744s1c1
Sequence:CCGGGATTTGGCTAAAGTCTCGGTACTCGAGTACCGAGACTTTAGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023054.1-279s1c1
Sequence:CCGGCAGGTAGATGAGTTCCATGAACTCGAGTTCATGGAACTCATCTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023054.1-944s1c1
Sequence:CCGGCTTGAACTATTGCGCCAACATCTCGAGATGTTGGCGCAATAGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023054.1-1002s1c1
Sequence:CCGGGCACATGGACATCCTGTTATACTCGAGTATAACAGGATGTCCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023054.1-1228s21c1
Sequence:CCGGGGGCTGCTCTCAAGTACTATACTCGAGTATAGTACTTGAGAGCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023054.1-946s21c1
Sequence:CCGGTGAACTATTGCGCCAACATTACTCGAGTAATGTTGGCGCAATAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023054.1-746s21c1
Sequence:CCGGTTTGGCTAAAGTCTCGGTAAACTCGAGTTTACCGAGACTTTAGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023054.1-914s21c1
Sequence:CCGGCGAATACCTGAAGACTAAGTACTCGAGTACTTAGTCTTCAGGTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023054.1-1336s21c1
Sequence:CCGGGAGCCATTACCTACCAGATTGCTCGAGCAATCTGGTAGGTAATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020368
VALIDATED
UTP3 MISSION shRNA Bacterial Glycerol Stock
UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_020368.1-1047s1c1
Sequence:CCGGCCTGTCATAGAAAGGCTTGTTCTCGAGAACAAGCCTTTCTATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020368.1-834s1c1
Sequence:CCGGGAACTCTTGGAGCTGATAGAACTCGAGTTCTATCAGCTCCAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020368.1-1428s1c1
Sequence:CCGGCCTAGGAGAAAGAAGATTGATCTCGAGATCAATCTTCTTTCTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020368.1-1118s1c1
Sequence:CCGGCTCAGAAATTCGTCATCTGTTCTCGAGAACAGATGACGAATTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020368.1-1239s1c1
Sequence:CCGGGCTGTTACAGATCTTTCTGATCTCGAGATCAGAAAGATCTGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135186    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020368.1-1854s1c1
Sequence:CCGGCACAGTTCATTGTGGAGTGTTCTCGAGAACACTCCACAATGAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020368.1-1533s1c1
Sequence:CCGGGAGCAACGTTATAGTGGTGAACTCGAGTTCACCACTATAACGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020368.1-1457s1c1
Sequence:CCGGCAGAGTGAAACACAGAGAGAACTCGAGTTCTCTCTGTGTTTCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_020368.2-1423s21c1
Sequence:CCGGGAGAGCTATTACCTATCAAATCTCGAGATTTGATAGGTAATAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020368.2-1765s21c1
Sequence:CCGGTGGGTTATTGGACAATTTATACTCGAGTATAAATTGTCCAATAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_020368.2-1277s21c1
Sequence:CCGGGCTGTTACAGATCTTTCTGATCTCGAGATCAGAAAGATCTGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_020368.2-872s21c1
Sequence:CCGGGAACTCTTGGAGCTGATAGAACTCGAGTTCTATCAGCTCCAAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020368.2-1085s21c1
Sequence:CCGGCCTGTCATAGAAAGGCTTGTTCTCGAGAACAAGCCTTTCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020368
VALIDATED
UTP3 MISSION shRNA shRNA Plasmid DNA
UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_020368.1-1047s1c1
Sequence:CCGGCCTGTCATAGAAAGGCTTGTTCTCGAGAACAAGCCTTTCTATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020368.1-834s1c1
Sequence:CCGGGAACTCTTGGAGCTGATAGAACTCGAGTTCTATCAGCTCCAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020368.1-1428s1c1
Sequence:CCGGCCTAGGAGAAAGAAGATTGATCTCGAGATCAATCTTCTTTCTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020368.1-1118s1c1
Sequence:CCGGCTCAGAAATTCGTCATCTGTTCTCGAGAACAGATGACGAATTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020368.1-1239s1c1
Sequence:CCGGGCTGTTACAGATCTTTCTGATCTCGAGATCAGAAAGATCTGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135186    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020368.1-1854s1c1
Sequence:CCGGCACAGTTCATTGTGGAGTGTTCTCGAGAACACTCCACAATGAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020368.1-1533s1c1
Sequence:CCGGGAGCAACGTTATAGTGGTGAACTCGAGTTCACCACTATAACGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020368.1-1457s1c1
Sequence:CCGGCAGAGTGAAACACAGAGAGAACTCGAGTTCTCTCTGTGTTTCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_020368.2-1423s21c1
Sequence:CCGGGAGAGCTATTACCTATCAAATCTCGAGATTTGATAGGTAATAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020368.2-1765s21c1
Sequence:CCGGTGGGTTATTGGACAATTTATACTCGAGTATAAATTGTCCAATAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_020368.2-1277s21c1
Sequence:CCGGGCTGTTACAGATCTTTCTGATCTCGAGATCAGAAAGATCTGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_020368.2-872s21c1
Sequence:CCGGGAACTCTTGGAGCTGATAGAACTCGAGTTCTATCAGCTCCAAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020368.2-1085s21c1
Sequence:CCGGCCTGTCATAGAAAGGCTTGTTCTCGAGAACAAGCCTTTCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020368
VALIDATED
UTP3 MISSION shRNA Lentiviral Transduction Particles
UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_020368.1-1047s1c1
Sequence:CCGGCCTGTCATAGAAAGGCTTGTTCTCGAGAACAAGCCTTTCTATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020368.1-834s1c1
Sequence:CCGGGAACTCTTGGAGCTGATAGAACTCGAGTTCTATCAGCTCCAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020368.1-1428s1c1
Sequence:CCGGCCTAGGAGAAAGAAGATTGATCTCGAGATCAATCTTCTTTCTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020368.1-1118s1c1
Sequence:CCGGCTCAGAAATTCGTCATCTGTTCTCGAGAACAGATGACGAATTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020368.1-1239s1c1
Sequence:CCGGGCTGTTACAGATCTTTCTGATCTCGAGATCAGAAAGATCTGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135186    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020368.1-1854s1c1
Sequence:CCGGCACAGTTCATTGTGGAGTGTTCTCGAGAACACTCCACAATGAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020368.1-1533s1c1
Sequence:CCGGGAGCAACGTTATAGTGGTGAACTCGAGTTCACCACTATAACGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020368.1-1457s1c1
Sequence:CCGGCAGAGTGAAACACAGAGAGAACTCGAGTTCTCTCTGTGTTTCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_020368.2-1423s21c1
Sequence:CCGGGAGAGCTATTACCTATCAAATCTCGAGATTTGATAGGTAATAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020368.2-1765s21c1
Sequence:CCGGTGGGTTATTGGACAATTTATACTCGAGTATAAATTGTCCAATAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_020368.2-1277s21c1
Sequence:CCGGGCTGTTACAGATCTTTCTGATCTCGAGATCAGAAAGATCTGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_020368.2-872s21c1
Sequence:CCGGGAACTCTTGGAGCTGATAGAACTCGAGTTCTATCAGCTCCAAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020368.2-1085s21c1
Sequence:CCGGCCTGTCATAGAAAGGCTTGTTCTCGAGAACAAGCCTTTCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks