EMAIL THIS PAGE TO A FRIEND

UTP6

UTP6, small subunit (SSU) processome component, homolog (yeast)

Synonyms: C17orf40 HCA66
UniProtKB ID: Q9NYH9, Q8IX96, Q96BL2, Q9NQ91
Gene ID:
Mouse(216987) UTP6, small subunit (SSU) processome component, homolog (yeast)
Rat(360574) UTP6, small subunit (SSU) processome component, homolog (yeast)
domestic guinea pig(100721060) UTP6, small subunit (SSU) processome component, homolog (yeast)
naked mole-rat(101720555) UTP6, small subunit (SSU) processome component, homolog (yeast)
cow(614984) UTP6, small subunit (SSU) processome component, homolog (yeast)
sheep(101122957) UTP6, small subunit (SSU) processome component, homolog (yeast)
Zebrafish(393107) UTP6, small subunit (SSU) processome component, homolog (yeast)
chicken(417405) UTP6, small subunit (SSU) processome component, homolog (yeast)
domestic cat(101089555) UTP6, small subunit (SSU) processome component, homolog (yeast)
Horse(100058568) UTP6, small subunit (SSU) processome component, homolog (yeast)
dog(480616) UTP6, small subunit (SSU) processome component, homolog (yeast)
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144826 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144826 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144826 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018428 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018428 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018428 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018428 Rosetta Predictions human pricing
XM_001080950 Rosetta Predictions rat pricing
XM_340853 Rosetta Predictions rat pricing
NM_144826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065816 predicted 1094
2 SASI_Hs01_00065817 predicted 425
3 SASI_Hs01_00065818 predicted 1520
4 SASI_Hs01_00065820 predicted 1694
5 SASI_Hs02_00351945 predicted 496
6 SASI_Hs01_00065821 predicted 1784
7 SASI_Hs01_00065823 predicted 1451
8 SASI_Hs01_00065824 predicted 816
9 SASI_Hs02_00351946 predicted 1128
10 SASI_Hs02_00351947 predicted 1527
11 SASI_Hs01_00065815 predicted 1668
12 SASI_Hs01_00065819 predicted 395
13 SASI_Hs01_00065822 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080950 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369990 predicted 461
2 SASI_Rn02_00369991 predicted 300
3 SASI_Rn02_00369992 predicted 474
4 SASI_Rn02_00369993 predicted 614
5 SASI_Rn02_00369994 predicted 1716
6 SASI_Rn02_00369995 predicted 1426
7 SASI_Rn02_00369996 predicted 291
8 SASI_Rn02_00369997 predicted 1788
9 SASI_Rn02_00369998 predicted 1542
10 SASI_Rn02_00369999 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340853 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00146834 predicted 261
2 SASI_Rn01_00146835 predicted 1375
3 SASI_Rn01_00146836 predicted 1074
4 SASI_Rn01_00146837 predicted 1440
5 SASI_Rn02_00392019 predicted 1429
6 SASI_Rn01_00146839 predicted 1187
7 SASI_Rn01_00146840 predicted 582
8 SASI_Rn01_00146841 predicted 496
9 SASI_Rn01_00146842 predicted 579
10 SASI_Rn01_00146843 predicted 660
11 SASI_Rn01_00146838 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131579 predicted 286
2 SASI_Mm01_00131580 predicted 971
3 SASI_Mm01_00131581 predicted 1694
4 SASI_Mm01_00131582 predicted 455
5 SASI_Mm01_00131583 predicted 802
6 SASI_Mm01_00131584 predicted 1333
7 SASI_Mm01_00131585 predicted 1890
8 SASI_Mm01_00131586 predicted 284
9 SASI_Mm01_00131587 predicted 1783
10 SASI_Mm01_00131588 predicted 1318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144826
VALIDATED
UTP6 MISSION shRNA Bacterial Glycerol Stock
UTP6, small subunit (SSU) processome component, homolog (yeast)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144826.3-1959s21c1
Sequence:CCGGGGCAGAAGAACGGATTGATTTCTCGAGAAATCAATCCGTTCTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144826.3-159s21c1
Sequence:CCGGCGCGGAGATTAAGGCTATCATCTCGAGATGATAGCCTTAATCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144826.3-1270s21c1
Sequence:CCGGGAATTGTTCAAGGACTCTGTACTCGAGTACAGAGTCCTTGAACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144826.3-833s21c1
Sequence:CCGGCCAAAGATCTACAGAAGGAAACTCGAGTTTCCTTCTGTAGATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144826.3-2254s21c1
Sequence:CCGGAGCTCCCGAATACTGATTAAGCTCGAGCTTAATCAGTATTCGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144826.2-2613s1c1
Sequence:CCGGCCCAAGATTATCCCAACACTACTCGAGTAGTGTTGGGATAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144826.2-160s1c1
Sequence:CCGGCGCGGAGATTAAGGCTATCATCTCGAGATGATAGCCTTAATCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144826.2-1177s1c1
Sequence:CCGGGCTGCTTTCTGAAGTCCAGTACTCGAGTACTGGACTTCAGAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144826.2-834s1c1
Sequence:CCGGCCAAAGATCTACAGAAGGAAACTCGAGTTTCCTTCTGTAGATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144826.2-1271s1c1
Sequence:CCGGGAATTGTTCAAGGACTCTGTACTCGAGTACAGAGTCCTTGAACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144826
VALIDATED
UTP6 MISSION shRNA shRNA Plasmid DNA
UTP6, small subunit (SSU) processome component, homolog (yeast)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144826.3-1959s21c1
Sequence:CCGGGGCAGAAGAACGGATTGATTTCTCGAGAAATCAATCCGTTCTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144826.3-159s21c1
Sequence:CCGGCGCGGAGATTAAGGCTATCATCTCGAGATGATAGCCTTAATCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144826.3-1270s21c1
Sequence:CCGGGAATTGTTCAAGGACTCTGTACTCGAGTACAGAGTCCTTGAACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144826.3-833s21c1
Sequence:CCGGCCAAAGATCTACAGAAGGAAACTCGAGTTTCCTTCTGTAGATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144826.3-2254s21c1
Sequence:CCGGAGCTCCCGAATACTGATTAAGCTCGAGCTTAATCAGTATTCGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144826.2-2613s1c1
Sequence:CCGGCCCAAGATTATCCCAACACTACTCGAGTAGTGTTGGGATAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144826.2-160s1c1
Sequence:CCGGCGCGGAGATTAAGGCTATCATCTCGAGATGATAGCCTTAATCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144826.2-1177s1c1
Sequence:CCGGGCTGCTTTCTGAAGTCCAGTACTCGAGTACTGGACTTCAGAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144826.2-834s1c1
Sequence:CCGGCCAAAGATCTACAGAAGGAAACTCGAGTTTCCTTCTGTAGATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144826.2-1271s1c1
Sequence:CCGGGAATTGTTCAAGGACTCTGTACTCGAGTACAGAGTCCTTGAACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144826
VALIDATED
UTP6 MISSION shRNA Lentiviral Transduction Particles
UTP6, small subunit (SSU) processome component, homolog (yeast)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144826.3-1959s21c1
Sequence:CCGGGGCAGAAGAACGGATTGATTTCTCGAGAAATCAATCCGTTCTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144826.3-159s21c1
Sequence:CCGGCGCGGAGATTAAGGCTATCATCTCGAGATGATAGCCTTAATCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144826.3-1270s21c1
Sequence:CCGGGAATTGTTCAAGGACTCTGTACTCGAGTACAGAGTCCTTGAACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144826.3-833s21c1
Sequence:CCGGCCAAAGATCTACAGAAGGAAACTCGAGTTTCCTTCTGTAGATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144826.3-2254s21c1
Sequence:CCGGAGCTCCCGAATACTGATTAAGCTCGAGCTTAATCAGTATTCGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144826.2-2613s1c1
Sequence:CCGGCCCAAGATTATCCCAACACTACTCGAGTAGTGTTGGGATAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144826.2-160s1c1
Sequence:CCGGCGCGGAGATTAAGGCTATCATCTCGAGATGATAGCCTTAATCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144826.2-1177s1c1
Sequence:CCGGGCTGCTTTCTGAAGTCCAGTACTCGAGTACTGGACTTCAGAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144826.2-834s1c1
Sequence:CCGGCCAAAGATCTACAGAAGGAAACTCGAGTTTCCTTCTGTAGATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144826.2-1271s1c1
Sequence:CCGGGAATTGTTCAAGGACTCTGTACTCGAGTACAGAGTCCTTGAACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018428
VALIDATED
UTP6 MISSION shRNA Bacterial Glycerol Stock
UTP6, small subunit (SSU) processome component, homolog (yeast)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018428.1-699s1c1
Sequence:CCGGCGAGTTGGCATGGATCATCTACTCGAGTAGATGATCCATGCCAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018428.1-658s1c1
Sequence:CCGGGATGTGGAGAATCCTGATTATCTCGAGATAATCAGGATTCTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018428.1-1789s1c1
Sequence:CCGGGAGGCATTTGTAGCTAAACATCTCGAGATGTTTAGCTACAAATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018428.1-781s1c1
Sequence:CCGGCAGCTATTTGACTTTGCCAAACTCGAGTTTGGCAAAGTCAAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018428.1-874s1c1
Sequence:CCGGGCAAGGCGAGAATTAGAGATTCTCGAGAATCTCTAATTCTCGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018428.1-423s1c1
Sequence:CCGGCAAGGTATTCTCTGCCATGTTCTCGAGAACATGGCAGAGAATACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018428.1-247s1c1
Sequence:CCGGCGGAGAAGAAGAACACGCATTCTCGAGAATGCGTGTTCTTCTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018428.1-103s1c1
Sequence:CCGGCGCATTGGACTGTTCAGTCATCTCGAGATGACTGAACAGTCCAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018428.1-1455s1c1
Sequence:CCGGCGACTCAGTAACCCTGAAGAACTCGAGTTCTTCAGGGTTACTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018428
VALIDATED
UTP6 MISSION shRNA shRNA Plasmid DNA
UTP6, small subunit (SSU) processome component, homolog (yeast)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018428.1-699s1c1
Sequence:CCGGCGAGTTGGCATGGATCATCTACTCGAGTAGATGATCCATGCCAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018428.1-658s1c1
Sequence:CCGGGATGTGGAGAATCCTGATTATCTCGAGATAATCAGGATTCTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018428.1-1789s1c1
Sequence:CCGGGAGGCATTTGTAGCTAAACATCTCGAGATGTTTAGCTACAAATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018428.1-781s1c1
Sequence:CCGGCAGCTATTTGACTTTGCCAAACTCGAGTTTGGCAAAGTCAAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018428.1-874s1c1
Sequence:CCGGGCAAGGCGAGAATTAGAGATTCTCGAGAATCTCTAATTCTCGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018428.1-423s1c1
Sequence:CCGGCAAGGTATTCTCTGCCATGTTCTCGAGAACATGGCAGAGAATACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018428.1-247s1c1
Sequence:CCGGCGGAGAAGAAGAACACGCATTCTCGAGAATGCGTGTTCTTCTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018428.1-103s1c1
Sequence:CCGGCGCATTGGACTGTTCAGTCATCTCGAGATGACTGAACAGTCCAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018428.1-1455s1c1
Sequence:CCGGCGACTCAGTAACCCTGAAGAACTCGAGTTCTTCAGGGTTACTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018428
VALIDATED
UTP6 MISSION shRNA Lentiviral Transduction Particles
UTP6, small subunit (SSU) processome component, homolog (yeast)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018428.1-699s1c1
Sequence:CCGGCGAGTTGGCATGGATCATCTACTCGAGTAGATGATCCATGCCAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018428.1-658s1c1
Sequence:CCGGGATGTGGAGAATCCTGATTATCTCGAGATAATCAGGATTCTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018428.1-1789s1c1
Sequence:CCGGGAGGCATTTGTAGCTAAACATCTCGAGATGTTTAGCTACAAATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018428.1-781s1c1
Sequence:CCGGCAGCTATTTGACTTTGCCAAACTCGAGTTTGGCAAAGTCAAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018428.1-874s1c1
Sequence:CCGGGCAAGGCGAGAATTAGAGATTCTCGAGAATCTCTAATTCTCGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018428.1-423s1c1
Sequence:CCGGCAAGGTATTCTCTGCCATGTTCTCGAGAACATGGCAGAGAATACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018428.1-247s1c1
Sequence:CCGGCGGAGAAGAAGAACACGCATTCTCGAGAATGCGTGTTCTTCTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018428.1-103s1c1
Sequence:CCGGCGCATTGGACTGTTCAGTCATCTCGAGATGACTGAACAGTCCAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018428.1-1455s1c1
Sequence:CCGGCGACTCAGTAACCCTGAAGAACTCGAGTTCTTCAGGGTTACTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks