EMAIL THIS PAGE TO A FRIEND

UTRN

utrophin

Synonyms: DMDL DRP DRP1
UniProtKB ID: P46939, Q5SZ57
Gene ID:
Human(7402) Summary: This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(22288) utrophin
Rat(25600) utrophin
chicken(421610) utrophin
dog(442965) utrophin
cow(534358) utrophin
sheep(101120168) utrophin
176 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011682 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011682 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011682 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007124 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007124 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007124 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051351 MISSION® esiRNA esiRNA human UTRN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007124 Rosetta Predictions human pricing
NM_013070 Rosetta Predictions rat pricing
NM_011682 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106309 predicted 6703
2 SASI_Hs01_00106310 predicted 1532
3 SASI_Hs02_00343000 predicted 230
4 SASI_Hs02_00343001 predicted 5975
5 SASI_Hs02_00343002 predicted 10407
6 SASI_Hs02_00343003 predicted 8301
7 SASI_Hs01_00106312 predicted 9569
8 SASI_Hs01_00106314 predicted 6072
9 SASI_Hs02_00343004 predicted 1789
10 SASI_Hs02_00343005 predicted 3803
11 SASI_Hs01_00106307 predicted 533
12 SASI_Hs01_00106308 predicted 6905
13 SASI_Hs01_00106311 predicted 9251
14 SASI_Hs01_00106313 predicted 8744
15 SASI_Hs01_00106315 predicted 5469
16 SASI_Hs01_00106316 predicted 1620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060461 predicted 5203
2 SASI_Rn02_00260818 predicted 3350
3 SASI_Rn01_00060462 predicted 1620
4 SASI_Rn01_00060463 predicted 3455
5 SASI_Rn01_00060464 predicted 4258
6 SASI_Rn01_00060466 predicted 8770
7 SASI_Rn02_00260819 predicted 9713
8 SASI_Rn01_00060468 predicted 5580
9 SASI_Rn01_00060469 predicted 2367
10 SASI_Rn02_00260820 predicted 2063
11 SASI_Rn01_00060465 predicted 4135
12 SASI_Rn01_00060467 predicted 3205
13 SASI_Rn01_00060470 predicted 5812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321229 predicted 5692
2 SASI_Mm01_00200176 predicted 2389
3 SASI_Mm01_00200177 predicted 3271
4 SASI_Mm01_00200178 predicted 855
5 SASI_Mm01_00200179 predicted 1525
6 SASI_Mm01_00200180 predicted 4157
7 SASI_Mm02_00321230 predicted 8007
8 SASI_Mm01_00200181 predicted 2965
9 SASI_Mm01_00200182 predicted 9422
10 SASI_Mm01_00200183 predicted 7935
11 SASI_Mm01_00200175 predicted 5463
12 SASI_Mm01_00200184 predicted 8635
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011682
VALIDATED
UTRN MISSION shRNA Bacterial Glycerol Stock
utrophin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011682.3-5041s1c1
Sequence:CCGGCCAGCGAGTAAACAGGAAGAACTCGAGTTCTTCCTGTTTACTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011682.3-9561s1c1
Sequence:CCGGCCACTCAAGAATAGAGCAATACTCGAGTATTGCTCTATTCTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011682.3-9560s1c1
Sequence:CCGGCCCACTCAAGAATAGAGCAATCTCGAGATTGCTCTATTCTTGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011682.3-10775s1c1
Sequence:CCGGGCCATACCAAACGAATAGATTCTCGAGAATCTATTCGTTTGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011682.3-6714s1c1
Sequence:CCGGGCTGGTATTGATCGACCAAATCTCGAGATTTGGTCGATCAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011682.4-5133s21c1
Sequence:CCGGCCAGCGAGTAAACAGGAAGAACTCGAGTTCTTCCTGTTTACTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011682.4-1796s21c1
Sequence:CCGGTGTCCGGCGTCTGGCTATATTCTCGAGAATATAGCCAGACGCCGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011682.4-9653s21c1
Sequence:CCGGCCACTCAAGAATAGAGCAATACTCGAGTATTGCTCTATTCTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011682.4-6806s21c1
Sequence:CCGGGCTGGTATTGATCGACCAAATCTCGAGATTTGGTCGATCAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011682.4-10387s21c1
Sequence:CCGGCTATCCAGCCAGCCAACATTTCTCGAGAAATGTTGGCTGGCTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011682
VALIDATED
UTRN MISSION shRNA shRNA Plasmid DNA
utrophin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011682.3-5041s1c1
Sequence:CCGGCCAGCGAGTAAACAGGAAGAACTCGAGTTCTTCCTGTTTACTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011682.3-9561s1c1
Sequence:CCGGCCACTCAAGAATAGAGCAATACTCGAGTATTGCTCTATTCTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011682.3-9560s1c1
Sequence:CCGGCCCACTCAAGAATAGAGCAATCTCGAGATTGCTCTATTCTTGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011682.3-10775s1c1
Sequence:CCGGGCCATACCAAACGAATAGATTCTCGAGAATCTATTCGTTTGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011682.3-6714s1c1
Sequence:CCGGGCTGGTATTGATCGACCAAATCTCGAGATTTGGTCGATCAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011682.4-5133s21c1
Sequence:CCGGCCAGCGAGTAAACAGGAAGAACTCGAGTTCTTCCTGTTTACTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011682.4-1796s21c1
Sequence:CCGGTGTCCGGCGTCTGGCTATATTCTCGAGAATATAGCCAGACGCCGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011682.4-9653s21c1
Sequence:CCGGCCACTCAAGAATAGAGCAATACTCGAGTATTGCTCTATTCTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011682.4-6806s21c1
Sequence:CCGGGCTGGTATTGATCGACCAAATCTCGAGATTTGGTCGATCAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011682.4-10387s21c1
Sequence:CCGGCTATCCAGCCAGCCAACATTTCTCGAGAAATGTTGGCTGGCTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011682
VALIDATED
UTRN MISSION shRNA Lentiviral Transduction Particles
utrophin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011682.3-5041s1c1
Sequence:CCGGCCAGCGAGTAAACAGGAAGAACTCGAGTTCTTCCTGTTTACTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011682.3-9561s1c1
Sequence:CCGGCCACTCAAGAATAGAGCAATACTCGAGTATTGCTCTATTCTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011682.3-9560s1c1
Sequence:CCGGCCCACTCAAGAATAGAGCAATCTCGAGATTGCTCTATTCTTGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011682.3-10775s1c1
Sequence:CCGGGCCATACCAAACGAATAGATTCTCGAGAATCTATTCGTTTGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011682.3-6714s1c1
Sequence:CCGGGCTGGTATTGATCGACCAAATCTCGAGATTTGGTCGATCAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011682.4-5133s21c1
Sequence:CCGGCCAGCGAGTAAACAGGAAGAACTCGAGTTCTTCCTGTTTACTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011682.4-1796s21c1
Sequence:CCGGTGTCCGGCGTCTGGCTATATTCTCGAGAATATAGCCAGACGCCGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011682.4-9653s21c1
Sequence:CCGGCCACTCAAGAATAGAGCAATACTCGAGTATTGCTCTATTCTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011682.4-6806s21c1
Sequence:CCGGGCTGGTATTGATCGACCAAATCTCGAGATTTGGTCGATCAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011682.4-10387s21c1
Sequence:CCGGCTATCCAGCCAGCCAACATTTCTCGAGAAATGTTGGCTGGCTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007124
VALIDATED
UTRN MISSION shRNA Bacterial Glycerol Stock
utrophin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007124.1-8482s1c1
Sequence:CCGGCCCTATTACATCAACCATCAACTCGAGTTGATGGTTGATGTAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007124.1-570s1c1
Sequence:CCGGCCGACATAAACCTGATCTCTTCTCGAGAAGAGATCAGGTTTATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007124.1-712s1c1
Sequence:CCGGCCTGACAAGAAATCCATAATTCTCGAGAATTATGGATTTCTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007124.1-5419s1c1
Sequence:CCGGGCCCAGATTGAGGAAGTTCTACTCGAGTAGAACTTCCTCAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007124.1-6354s1c1
Sequence:CCGGCCTGCAAGAATTAAGAGACTTCTCGAGAAGTCTCTTAATTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007124.2-6806s21c1
Sequence:CCGGAGCCGACTGGCTGGTATTAATCTCGAGATTAATACCAGCCAGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007124.2-9981s21c1
Sequence:CCGGTCACCGCCAGAGTCGATTATACTCGAGTATAATCGACTCTGGCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007124.2-5511s21c1
Sequence:CCGGGCCCAGATTGAGGAAGTTCTACTCGAGTAGAACTTCCTCAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007124.2-6748s21c1
Sequence:CCGGCTCATCGTACTTCGGAAATTTCTCGAGAAATTTCCGAAGTACGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007124.2-10892s21c1
Sequence:CCGGTATGTTTATCAGCCATATAACCTCGAGGTTATATGGCTGATAAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007124
VALIDATED
UTRN MISSION shRNA shRNA Plasmid DNA
utrophin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007124.1-8482s1c1
Sequence:CCGGCCCTATTACATCAACCATCAACTCGAGTTGATGGTTGATGTAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007124.1-570s1c1
Sequence:CCGGCCGACATAAACCTGATCTCTTCTCGAGAAGAGATCAGGTTTATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007124.1-712s1c1
Sequence:CCGGCCTGACAAGAAATCCATAATTCTCGAGAATTATGGATTTCTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007124.1-5419s1c1
Sequence:CCGGGCCCAGATTGAGGAAGTTCTACTCGAGTAGAACTTCCTCAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007124.1-6354s1c1
Sequence:CCGGCCTGCAAGAATTAAGAGACTTCTCGAGAAGTCTCTTAATTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007124.2-6806s21c1
Sequence:CCGGAGCCGACTGGCTGGTATTAATCTCGAGATTAATACCAGCCAGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007124.2-9981s21c1
Sequence:CCGGTCACCGCCAGAGTCGATTATACTCGAGTATAATCGACTCTGGCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007124.2-5511s21c1
Sequence:CCGGGCCCAGATTGAGGAAGTTCTACTCGAGTAGAACTTCCTCAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007124.2-6748s21c1
Sequence:CCGGCTCATCGTACTTCGGAAATTTCTCGAGAAATTTCCGAAGTACGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007124.2-10892s21c1
Sequence:CCGGTATGTTTATCAGCCATATAACCTCGAGGTTATATGGCTGATAAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007124
VALIDATED
UTRN MISSION shRNA Lentiviral Transduction Particles
utrophin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007124.1-8482s1c1
Sequence:CCGGCCCTATTACATCAACCATCAACTCGAGTTGATGGTTGATGTAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007124.1-570s1c1
Sequence:CCGGCCGACATAAACCTGATCTCTTCTCGAGAAGAGATCAGGTTTATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007124.1-712s1c1
Sequence:CCGGCCTGACAAGAAATCCATAATTCTCGAGAATTATGGATTTCTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007124.1-5419s1c1
Sequence:CCGGGCCCAGATTGAGGAAGTTCTACTCGAGTAGAACTTCCTCAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007124.1-6354s1c1
Sequence:CCGGCCTGCAAGAATTAAGAGACTTCTCGAGAAGTCTCTTAATTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007124.2-6806s21c1
Sequence:CCGGAGCCGACTGGCTGGTATTAATCTCGAGATTAATACCAGCCAGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007124.2-9981s21c1
Sequence:CCGGTCACCGCCAGAGTCGATTATACTCGAGTATAATCGACTCTGGCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007124.2-5511s21c1
Sequence:CCGGGCCCAGATTGAGGAAGTTCTACTCGAGTAGAACTTCCTCAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007124.2-6748s21c1
Sequence:CCGGCTCATCGTACTTCGGAAATTTCTCGAGAAATTTCCGAAGTACGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007124.2-10892s21c1
Sequence:CCGGTATGTTTATCAGCCATATAACCTCGAGGTTATATGGCTGATAAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks