EMAIL THIS PAGE TO A FRIEND

UTS2

urotensin 2

Synonyms: PRO1068 U-II UCN2 UII
UniProtKB ID: O95399, Q5H8X7, Q6UXF6, Q9UKP7
Gene ID:
Human(10911) Summary: This gene encodes a mature peptide that is an active cyclic heptapeptide absolutely conserved from lamprey to human. The active peptide acts as a vasoconstrictor and is expressed only in brain tissue. Despite the gene family name similarity, this gene is not homologous to urocortin, a member of the sauvagine/corticotropin-releasing factor/urotensin I family. Most of the proprotein is cleaved to make the mature peptide. Transcript variants encoding different preproprotein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(24111) urotensin 2
Rat(29180) urotensin 2
chicken(404535) urotensin 2
cow(100295833) urotensin 2
sheep(101120003) urotensin 2
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006786 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011910 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011910 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011910 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152271 MISSION® esiRNA esiRNA human UTS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006786 Rosetta Predictions human pricing
NM_021995 Rosetta Predictions human pricing
NM_019160 Rosetta Predictions rat pricing
NM_011910 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028417 predicted 242
2 SASI_Hs01_00028418 predicted 234
3 SASI_Hs01_00028419 predicted 266
4 SASI_Hs01_00028420 predicted 269
5 SASI_Hs01_00028421 predicted 293
6 SASI_Hs01_00028422 predicted 304
7 SASI_Hs02_00342306 predicted 292
8 SASI_Hs01_00028424 predicted 276
9 SASI_Hs01_00028425 predicted 266
10 SASI_Hs01_00028426 predicted 234
11 SASI_Hs01_00028423 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194493 predicted 236
2 SASI_Hs01_00194494 predicted 261
3 SASI_Hs01_00194495 predicted 331
4 SASI_Hs01_00194496 predicted 247
5 SASI_Hs01_00194497 predicted 362
6 SASI_Hs01_00194498 predicted 389
7 SASI_Hs01_00194499 predicted 200
8 SASI_Hs01_00194500 predicted 223
9 SASI_Hs02_00355364 predicted 383
10 SASI_Hs01_00194502 predicted 263
11 SASI_Hs01_00194501 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019160 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109946 predicted 294
2 SASI_Rn01_00109947 predicted 293
3 SASI_Rn01_00109948 predicted 292
4 SASI_Rn02_00261941 predicted 282
5 SASI_Rn01_00109950 predicted 289
6 SASI_Rn01_00109951 predicted 286
7 SASI_Rn01_00109952 predicted 200
8 SASI_Rn01_00109953 predicted 199
9 SASI_Rn02_00261942 predicted 215
10 SASI_Rn01_00109954 predicted 287
11 SASI_Rn01_00109949 predicted 304
12 SASI_Rn01_00109955 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103314 predicted 282
2 SASI_Mm01_00103315 predicted 284
3 SASI_Mm01_00103316 predicted 285
4 SASI_Mm01_00103317 predicted 309
5 SASI_Mm01_00103318 predicted 253
6 SASI_Mm01_00103319 predicted 202
7 SASI_Mm01_00103320 predicted 239
8 SASI_Mm01_00103321 predicted 197
9 SASI_Mm01_00103322 predicted 375
10 SASI_Mm02_00321733 predicted 373
11 SASI_Mm01_00103323 predicted 352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006786
UTS2 MISSION shRNA Bacterial Glycerol Stock
urotensin 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006786.2-234s1c1
Sequence:CCGGCTCAGGAAAGCAGACTCAAGTCTCGAGACTTGAGTCTGCTTTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006786.2-269s1c1
Sequence:CCGGCCCAAGAGGAAATTTGAGAAACTCGAGTTTCTCAAATTTCCTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006786.2-346s1c1
Sequence:CCGGGAATCTGGAAACCATACAAGACTCGAGTCTTGTATGGTTTCCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006786.2-353s1c1
Sequence:CCGGGAAACCATACAAGAAACGTGACTCGAGTCACGTTTCTTGTATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006786.2-344s1c1
Sequence:CCGGCAGAATCTGGAAACCATACAACTCGAGTTGTATGGTTTCCAGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006786.2-239s1c1
Sequence:CCGGGAAAGCAGACTCAAGTACCAACTCGAGTTGGTACTTGAGTCTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006786.2-385s1c1
Sequence:CCGGGCTTCTGGAAATACTGTGTCTCTCGAGAGACACAGTATTTCCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006786.2-374s1c1
Sequence:CCGGGACTCCTGATTGCTTCTGGAACTCGAGTTCCAGAAGCAATCAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006786.2-168s1c1
Sequence:CCGGGAGCTAGAAAGAGCTTCCCTTCTCGAGAAGGGAAGCTCTTTCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006786
UTS2 MISSION shRNA shRNA Plasmid DNA
urotensin 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006786.2-234s1c1
Sequence:CCGGCTCAGGAAAGCAGACTCAAGTCTCGAGACTTGAGTCTGCTTTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006786.2-269s1c1
Sequence:CCGGCCCAAGAGGAAATTTGAGAAACTCGAGTTTCTCAAATTTCCTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006786.2-346s1c1
Sequence:CCGGGAATCTGGAAACCATACAAGACTCGAGTCTTGTATGGTTTCCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006786.2-353s1c1
Sequence:CCGGGAAACCATACAAGAAACGTGACTCGAGTCACGTTTCTTGTATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006786.2-344s1c1
Sequence:CCGGCAGAATCTGGAAACCATACAACTCGAGTTGTATGGTTTCCAGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006786.2-239s1c1
Sequence:CCGGGAAAGCAGACTCAAGTACCAACTCGAGTTGGTACTTGAGTCTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006786.2-385s1c1
Sequence:CCGGGCTTCTGGAAATACTGTGTCTCTCGAGAGACACAGTATTTCCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006786.2-374s1c1
Sequence:CCGGGACTCCTGATTGCTTCTGGAACTCGAGTTCCAGAAGCAATCAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006786.2-168s1c1
Sequence:CCGGGAGCTAGAAAGAGCTTCCCTTCTCGAGAAGGGAAGCTCTTTCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006786
UTS2 MISSION shRNA Lentiviral Transduction Particles
urotensin 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006786.2-234s1c1
Sequence:CCGGCTCAGGAAAGCAGACTCAAGTCTCGAGACTTGAGTCTGCTTTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006786.2-269s1c1
Sequence:CCGGCCCAAGAGGAAATTTGAGAAACTCGAGTTTCTCAAATTTCCTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006786.2-346s1c1
Sequence:CCGGGAATCTGGAAACCATACAAGACTCGAGTCTTGTATGGTTTCCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006786.2-353s1c1
Sequence:CCGGGAAACCATACAAGAAACGTGACTCGAGTCACGTTTCTTGTATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006786.2-344s1c1
Sequence:CCGGCAGAATCTGGAAACCATACAACTCGAGTTGTATGGTTTCCAGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006786.2-239s1c1
Sequence:CCGGGAAAGCAGACTCAAGTACCAACTCGAGTTGGTACTTGAGTCTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006786.2-385s1c1
Sequence:CCGGGCTTCTGGAAATACTGTGTCTCTCGAGAGACACAGTATTTCCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006786.2-374s1c1
Sequence:CCGGGACTCCTGATTGCTTCTGGAACTCGAGTTCCAGAAGCAATCAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006786.2-168s1c1
Sequence:CCGGGAGCTAGAAAGAGCTTCCCTTCTCGAGAAGGGAAGCTCTTTCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011910
UTS2 MISSION shRNA Bacterial Glycerol Stock
urotensin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011910.1-384s1c1
Sequence:CCGGGTGCTTCTGGAAATACTGCATCTCGAGATGCAGTATTTCCAGAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011910.1-109s1c1
Sequence:CCGGGACACTGGTGAGAGGACTCTTCTCGAGAAGAGTCCTCTCACCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011910.1-64s1c1
Sequence:CCGGCTCTTCATAGGACTTCTGAATCTCGAGATTCAGAAGTCCTATGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011910.1-346s1c1
Sequence:CCGGACCAGGAAACAACATAAGCAACTCGAGTTGCTTATGTTGTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011910.1-318s1c1
Sequence:CCGGCACTGTACTGAGTCGTCTCTTCTCGAGAAGAGACGACTCAGTACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011910
UTS2 MISSION shRNA shRNA Plasmid DNA
urotensin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011910.1-384s1c1
Sequence:CCGGGTGCTTCTGGAAATACTGCATCTCGAGATGCAGTATTTCCAGAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011910.1-109s1c1
Sequence:CCGGGACACTGGTGAGAGGACTCTTCTCGAGAAGAGTCCTCTCACCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011910.1-64s1c1
Sequence:CCGGCTCTTCATAGGACTTCTGAATCTCGAGATTCAGAAGTCCTATGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011910.1-346s1c1
Sequence:CCGGACCAGGAAACAACATAAGCAACTCGAGTTGCTTATGTTGTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011910.1-318s1c1
Sequence:CCGGCACTGTACTGAGTCGTCTCTTCTCGAGAAGAGACGACTCAGTACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011910
UTS2 MISSION shRNA Lentiviral Transduction Particles
urotensin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011910.1-384s1c1
Sequence:CCGGGTGCTTCTGGAAATACTGCATCTCGAGATGCAGTATTTCCAGAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011910.1-109s1c1
Sequence:CCGGGACACTGGTGAGAGGACTCTTCTCGAGAAGAGTCCTCTCACCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011910.1-64s1c1
Sequence:CCGGCTCTTCATAGGACTTCTGAATCTCGAGATTCAGAAGTCCTATGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011910.1-346s1c1
Sequence:CCGGACCAGGAAACAACATAAGCAACTCGAGTTGCTTATGTTGTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011910.1-318s1c1
Sequence:CCGGCACTGTACTGAGTCGTCTCTTCTCGAGAAGAGACGACTCAGTACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks