EMAIL THIS PAGE TO A FRIEND

UTS2B

urotensin 2B

Synonyms: U2B URP UTS2D
UniProtKB ID: Q765I0, B3KQY8, D3DNW1, Q2M1Z2
Gene ID:
Mouse(224065) urotensin 2B
Rat(378939) urotensin 2B
Zebrafish(402853) urotensin 2, beta
cow(614653) urotensin 2B
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198166 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198166 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198166 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198152 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055371 MISSION® esiRNA esiRNA human UTS2D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198152 Rosetta Predictions human pricing
NM_198133 Rosetta Predictions rat pricing
NM_198166 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127518 predicted 254
2 SASI_Hs01_00127519 predicted 261
3 SASI_Hs01_00127520 predicted 262
4 SASI_Hs01_00127521 predicted 256
5 SASI_Hs01_00127522 predicted 201
6 SASI_Hs01_00127523 predicted 102
7 SASI_Hs01_00127524 predicted 82
8 SASI_Hs01_00127525 predicted 77
9 SASI_Hs01_00127526 predicted 78
10 SASI_Hs01_00127527 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098285 predicted 207
2 SASI_Rn01_00098286 predicted 208
3 SASI_Rn01_00098287 predicted 199
4 SASI_Rn01_00098288 predicted 206
5 SASI_Rn01_00098289 predicted 218
6 SASI_Rn01_00098290 predicted 341
7 SASI_Rn01_00098291 predicted 152
8 SASI_Rn02_00269918 predicted 620
9 SASI_Rn01_00098292 predicted 629
10 SASI_Rn01_00098293 predicted 298
11 SASI_Rn01_00098294 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350875 predicted 558
2 SASI_Mm01_00105433 predicted 490
3 SASI_Mm01_00105434 predicted 365
4 SASI_Mm01_00105435 predicted 427
5 SASI_Mm01_00105436 predicted 300
6 SASI_Mm01_00105438 predicted 331
7 SASI_Mm01_00105439 predicted 324
8 SASI_Mm01_00105440 predicted 513
9 SASI_Mm01_00105441 predicted 202
10 SASI_Mm02_00350876 predicted 246
11 SASI_Mm01_00105437 predicted 485
12 SASI_Mm01_00105442 predicted 604
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198166
UTS2B MISSION shRNA Bacterial Glycerol Stock
urotensin 2B
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198166.2-198s1c1
Sequence:CCGGGCTCAGGACATGAGTTGTTTCCTCGAGGAAACAACTCATGTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198166.2-206s1c1
Sequence:CCGGCATGAGTTGTTTCCAGCTAAACTCGAGTTTAGCTGGAAACAACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198166.2-608s1c1
Sequence:CCGGCCTGGGTTACGGCTTACTTAACTCGAGTTAAGTAAGCCGTAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198166.2-370s1c1
Sequence:CCGGGCTGTCCAATGCTTTAGACAACTCGAGTTGTCTAAAGCATTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198166.2-455s1c1
Sequence:CCGGGAATAGACAGAAGAGAAGAAACTCGAGTTTCTTCTCTTCTGTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198166.2-137s1c1
Sequence:CCGGCTCCTGACTTTGTTGTCTGTACTCGAGTACAGACAACAAAGTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198166.3-248s21c1
Sequence:CCGGTTGACCCGAAATCCTGGTTTACTCGAGTAAACCAGGATTTCGGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198166.3-660s21c1
Sequence:CCGCACTCTGGAATGGAACTGTCATCTCGAGATGACAGTTCCATTCCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198166.3-430s1c1
Sequence:CCGGGAAGTACTGTGTCTGAGATATCTCGAGATATCTCAGACACAGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198166.3-630s21c1
Sequence:CCGGGCTCATTCAGTGAACAATTGCCTCGAGGCAATTGTTCACTGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198166.3-311s21c1
Sequence:CCGGGAAGAACTTAGACAGGTAAAGCTCGAGCTTTACCTGTCTAAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198166.3-562s21c1
Sequence:CCGGCCCTTGTTCTGCACATCATTTCTCGAGAAATGATGTGCAGAACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198166
UTS2B MISSION shRNA shRNA Plasmid DNA
urotensin 2B
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198166.2-198s1c1
Sequence:CCGGGCTCAGGACATGAGTTGTTTCCTCGAGGAAACAACTCATGTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198166.2-206s1c1
Sequence:CCGGCATGAGTTGTTTCCAGCTAAACTCGAGTTTAGCTGGAAACAACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198166.2-608s1c1
Sequence:CCGGCCTGGGTTACGGCTTACTTAACTCGAGTTAAGTAAGCCGTAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198166.2-370s1c1
Sequence:CCGGGCTGTCCAATGCTTTAGACAACTCGAGTTGTCTAAAGCATTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198166.2-455s1c1
Sequence:CCGGGAATAGACAGAAGAGAAGAAACTCGAGTTTCTTCTCTTCTGTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198166.2-137s1c1
Sequence:CCGGCTCCTGACTTTGTTGTCTGTACTCGAGTACAGACAACAAAGTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198166.3-248s21c1
Sequence:CCGGTTGACCCGAAATCCTGGTTTACTCGAGTAAACCAGGATTTCGGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198166.3-660s21c1
Sequence:CCGCACTCTGGAATGGAACTGTCATCTCGAGATGACAGTTCCATTCCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198166.3-430s1c1
Sequence:CCGGGAAGTACTGTGTCTGAGATATCTCGAGATATCTCAGACACAGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198166.3-630s21c1
Sequence:CCGGGCTCATTCAGTGAACAATTGCCTCGAGGCAATTGTTCACTGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198166.3-311s21c1
Sequence:CCGGGAAGAACTTAGACAGGTAAAGCTCGAGCTTTACCTGTCTAAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198166.3-562s21c1
Sequence:CCGGCCCTTGTTCTGCACATCATTTCTCGAGAAATGATGTGCAGAACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198166
UTS2B MISSION shRNA Lentiviral Transduction Particles
urotensin 2B
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198166.2-198s1c1
Sequence:CCGGGCTCAGGACATGAGTTGTTTCCTCGAGGAAACAACTCATGTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198166.2-206s1c1
Sequence:CCGGCATGAGTTGTTTCCAGCTAAACTCGAGTTTAGCTGGAAACAACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198166.2-608s1c1
Sequence:CCGGCCTGGGTTACGGCTTACTTAACTCGAGTTAAGTAAGCCGTAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198166.2-370s1c1
Sequence:CCGGGCTGTCCAATGCTTTAGACAACTCGAGTTGTCTAAAGCATTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198166.2-455s1c1
Sequence:CCGGGAATAGACAGAAGAGAAGAAACTCGAGTTTCTTCTCTTCTGTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198166.2-137s1c1
Sequence:CCGGCTCCTGACTTTGTTGTCTGTACTCGAGTACAGACAACAAAGTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198166.3-248s21c1
Sequence:CCGGTTGACCCGAAATCCTGGTTTACTCGAGTAAACCAGGATTTCGGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198166.3-660s21c1
Sequence:CCGCACTCTGGAATGGAACTGTCATCTCGAGATGACAGTTCCATTCCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198166.3-430s1c1
Sequence:CCGGGAAGTACTGTGTCTGAGATATCTCGAGATATCTCAGACACAGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198166.3-630s21c1
Sequence:CCGGGCTCATTCAGTGAACAATTGCCTCGAGGCAATTGTTCACTGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198166.3-311s21c1
Sequence:CCGGGAAGAACTTAGACAGGTAAAGCTCGAGCTTTACCTGTCTAAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198166.3-562s21c1
Sequence:CCGGCCCTTGTTCTGCACATCATTTCTCGAGAAATGATGTGCAGAACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198152
UTS2B MISSION shRNA Bacterial Glycerol Stock
urotensin 2B
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-227s1c1
Sequence:CCGGGATTTCCAAAGACCTTTCAACCTCGAGGTTGAAAGGTCTTTGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-259s1c1
Sequence:CCGGCTTACCTAACAAACTGGAAGACTCGAGTCTTCCAGTTTGTTAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198152.1-263s1c1
Sequence:CCGGCCTAACAAACTGGAAGAACTTCTCGAGAAGTTCTTCCAGTTTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198152.1-137s1c1
Sequence:CCGGCCATATCTTACCCAAGGAAATCTCGAGATTTCCTTGGGTAAGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-135s1c1
Sequence:CCGGGACCATATCTTACCCAAGGAACTCGAGTTCCTTGGGTAAGATATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-251s1c1
Sequence:CCGGGACCTAGCCTTACCTAACAAACTCGAGTTTGTTAGGTAAGGCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-232s1c1
Sequence:CCGGCCAAAGACCTTTCAACACTGACTCGAGTCAGTGTTGAAAGGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198152.1-247s1c1
Sequence:CCGGCACTGACCTAGCCTTACCTAACTCGAGTTAGGTAAGGCTAGGTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198152.1-191s1c1
Sequence:CCGGGAGGAACTATTGCTGGCTCTACTCGAGTAGAGCCAGCAATAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-237s1c1
Sequence:CCGGGACCTTTCAACACTGACCTAGCTCGAGCTAGGTCAGTGTTGAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-194s1c1
Sequence:CCGGGAACTATTGCTGGCTCTACTGCTCGAGCAGTAGAGCCAGCAATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198152.1-78s1c1
Sequence:CCGGGCTTTGGACTCCTAACTTTGTCTCGAGACAAAGTTAGGAGTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-275s1c1
Sequence:CCGGGAAGAACTTAACCAGCTGGAACTCGAGTTCCAGCTGGTTAAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198152
UTS2B MISSION shRNA shRNA Plasmid DNA
urotensin 2B
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-227s1c1
Sequence:CCGGGATTTCCAAAGACCTTTCAACCTCGAGGTTGAAAGGTCTTTGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-259s1c1
Sequence:CCGGCTTACCTAACAAACTGGAAGACTCGAGTCTTCCAGTTTGTTAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198152.1-263s1c1
Sequence:CCGGCCTAACAAACTGGAAGAACTTCTCGAGAAGTTCTTCCAGTTTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198152.1-137s1c1
Sequence:CCGGCCATATCTTACCCAAGGAAATCTCGAGATTTCCTTGGGTAAGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-135s1c1
Sequence:CCGGGACCATATCTTACCCAAGGAACTCGAGTTCCTTGGGTAAGATATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-251s1c1
Sequence:CCGGGACCTAGCCTTACCTAACAAACTCGAGTTTGTTAGGTAAGGCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-232s1c1
Sequence:CCGGCCAAAGACCTTTCAACACTGACTCGAGTCAGTGTTGAAAGGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198152.1-247s1c1
Sequence:CCGGCACTGACCTAGCCTTACCTAACTCGAGTTAGGTAAGGCTAGGTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198152.1-191s1c1
Sequence:CCGGGAGGAACTATTGCTGGCTCTACTCGAGTAGAGCCAGCAATAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-237s1c1
Sequence:CCGGGACCTTTCAACACTGACCTAGCTCGAGCTAGGTCAGTGTTGAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-194s1c1
Sequence:CCGGGAACTATTGCTGGCTCTACTGCTCGAGCAGTAGAGCCAGCAATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198152.1-78s1c1
Sequence:CCGGGCTTTGGACTCCTAACTTTGTCTCGAGACAAAGTTAGGAGTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-275s1c1
Sequence:CCGGGAAGAACTTAACCAGCTGGAACTCGAGTTCCAGCTGGTTAAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198152
UTS2B MISSION shRNA Lentiviral Transduction Particles
urotensin 2B
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-227s1c1
Sequence:CCGGGATTTCCAAAGACCTTTCAACCTCGAGGTTGAAAGGTCTTTGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-259s1c1
Sequence:CCGGCTTACCTAACAAACTGGAAGACTCGAGTCTTCCAGTTTGTTAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198152.1-263s1c1
Sequence:CCGGCCTAACAAACTGGAAGAACTTCTCGAGAAGTTCTTCCAGTTTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198152.1-137s1c1
Sequence:CCGGCCATATCTTACCCAAGGAAATCTCGAGATTTCCTTGGGTAAGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-135s1c1
Sequence:CCGGGACCATATCTTACCCAAGGAACTCGAGTTCCTTGGGTAAGATATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-251s1c1
Sequence:CCGGGACCTAGCCTTACCTAACAAACTCGAGTTTGTTAGGTAAGGCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-232s1c1
Sequence:CCGGCCAAAGACCTTTCAACACTGACTCGAGTCAGTGTTGAAAGGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198152.1-247s1c1
Sequence:CCGGCACTGACCTAGCCTTACCTAACTCGAGTTAGGTAAGGCTAGGTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198152.1-191s1c1
Sequence:CCGGGAGGAACTATTGCTGGCTCTACTCGAGTAGAGCCAGCAATAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-237s1c1
Sequence:CCGGGACCTTTCAACACTGACCTAGCTCGAGCTAGGTCAGTGTTGAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-194s1c1
Sequence:CCGGGAACTATTGCTGGCTCTACTGCTCGAGCAGTAGAGCCAGCAATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198152.1-78s1c1
Sequence:CCGGGCTTTGGACTCCTAACTTTGTCTCGAGACAAAGTTAGGAGTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198152.1-275s1c1
Sequence:CCGGGAAGAACTTAACCAGCTGGAACTCGAGTTCCAGCTGGTTAAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks