EMAIL THIS PAGE TO A FRIEND

UTS2R

urotensin 2 receptor

Synonyms: GPR14 UR-2-R UTR UTR2
UniProtKB ID: Q9UKP6, B2RMV8
Gene ID:
Mouse(217369) urotensin 2 receptor
Rat(57305) urotensin 2 receptor
chicken(427800) urotensin 2 receptor
domestic cat(554343) urotensin 2 receptor
dog(491678) urotensin 2 receptor
cow(286969) urotensin 2 receptor
sheep(101110604) urotensin 2 receptor
domestic guinea pig(100717445) urotensin 2 receptor
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
A0355 AC-7954 ≥98% (HPLC), solid human pricing
594687 α-Sexithiophene human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145440 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145440 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145440 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018949 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018949 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018949 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018949 Rosetta Predictions human pricing
NM_020537 Rosetta Predictions rat pricing
NM_145440 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164954 predicted 246
2 SASI_Hs01_00164955 predicted 199
3 SASI_Hs01_00164956 predicted 231
4 SASI_Hs01_00164957 predicted 237
5 SASI_Hs01_00164958 predicted 239
6 SASI_Hs01_00164959 predicted 232
7 SASI_Hs01_00164960 predicted 235
8 SASI_Hs01_00164961 predicted 204
9 SASI_Hs01_00164962 predicted 667
10 SASI_Hs01_00164963 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020537 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086002 predicted 705
2 SASI_Rn01_00086004 predicted 478
3 SASI_Rn01_00086005 predicted 899
4 SASI_Rn01_00086006 predicted 330
5 SASI_Rn01_00086007 predicted 325
6 SASI_Rn01_00086008 predicted 904
7 SASI_Rn02_00262555 predicted 301
8 SASI_Rn01_00086009 predicted 840
9 SASI_Rn01_00086010 predicted 666
10 SASI_Rn01_00086011 predicted 394
11 SASI_Rn01_00086003 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088226 predicted 1349
2 SASI_Mm01_00088228 predicted 704
3 SASI_Mm01_00088229 predicted 755
4 SASI_Mm01_00088230 predicted 658
5 SASI_Mm01_00088231 predicted 434
6 SASI_Mm01_00088232 predicted 1336
7 SASI_Mm01_00088233 predicted 1357
8 SASI_Mm01_00088234 predicted 365
9 SASI_Mm01_00088235 predicted 1373
10 SASI_Mm02_00340819 predicted 820
11 SASI_Mm01_00088227 predicted 296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145440
UTS2R MISSION shRNA Bacterial Glycerol Stock
urotensin 2 receptor
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145440.1-1328s21c1
Sequence:CCGGGTTGTTCTCATCAGCTCTATCCTCGAGGATAGAGCTGATGAGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145440.1-360s21c1
Sequence:CCGGGTAGCCACCTACGTCACTAAGCTCGAGCTTAGTGACGTAGGTGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145440.1-821s1c1
Sequence:CCGGCCTTGGTATCGTCCTTCTCTTCTCGAGAAGAGAAGGACGATACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145440.1-1366s1c1
Sequence:CCGGGCCAATACATTCCTGCTTCAACTCGAGTTGAAGCAGGAATGTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145440.1-998s1c1
Sequence:CCGGCACCAAGAACTACCGTGAGTACTCGAGTACTCACGGTAGTTCTTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145440.1-459s1c1
Sequence:CCGGCTGACCATAATGAGCAGTGAACTCGAGTTCACTGCTCATTATGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145440.1-330s1c1
Sequence:CCGGCTGCTGTATCTGCTGAGCATTCTCGAGAATGCTCAGCAGATACAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145440
UTS2R MISSION shRNA shRNA Plasmid DNA
urotensin 2 receptor
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145440.1-1328s21c1
Sequence:CCGGGTTGTTCTCATCAGCTCTATCCTCGAGGATAGAGCTGATGAGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145440.1-360s21c1
Sequence:CCGGGTAGCCACCTACGTCACTAAGCTCGAGCTTAGTGACGTAGGTGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145440.1-821s1c1
Sequence:CCGGCCTTGGTATCGTCCTTCTCTTCTCGAGAAGAGAAGGACGATACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145440.1-1366s1c1
Sequence:CCGGGCCAATACATTCCTGCTTCAACTCGAGTTGAAGCAGGAATGTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145440.1-998s1c1
Sequence:CCGGCACCAAGAACTACCGTGAGTACTCGAGTACTCACGGTAGTTCTTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145440.1-459s1c1
Sequence:CCGGCTGACCATAATGAGCAGTGAACTCGAGTTCACTGCTCATTATGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145440.1-330s1c1
Sequence:CCGGCTGCTGTATCTGCTGAGCATTCTCGAGAATGCTCAGCAGATACAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145440
UTS2R MISSION shRNA Lentiviral Transduction Particles
urotensin 2 receptor
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145440.1-1328s21c1
Sequence:CCGGGTTGTTCTCATCAGCTCTATCCTCGAGGATAGAGCTGATGAGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145440.1-360s21c1
Sequence:CCGGGTAGCCACCTACGTCACTAAGCTCGAGCTTAGTGACGTAGGTGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145440.1-821s1c1
Sequence:CCGGCCTTGGTATCGTCCTTCTCTTCTCGAGAAGAGAAGGACGATACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145440.1-1366s1c1
Sequence:CCGGGCCAATACATTCCTGCTTCAACTCGAGTTGAAGCAGGAATGTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145440.1-998s1c1
Sequence:CCGGCACCAAGAACTACCGTGAGTACTCGAGTACTCACGGTAGTTCTTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145440.1-459s1c1
Sequence:CCGGCTGACCATAATGAGCAGTGAACTCGAGTTCACTGCTCATTATGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145440.1-330s1c1
Sequence:CCGGCTGCTGTATCTGCTGAGCATTCTCGAGAATGCTCAGCAGATACAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018949
VALIDATED
UTS2R MISSION shRNA Bacterial Glycerol Stock
urotensin 2 receptor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018949.1-396s21c1
Sequence:CCGGGACCATGCACGCCAGCATCTTCTCGAGAAGATGCTGGCGTGCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018949.1-413s21c1
Sequence:CCGGTCTTCACGCTGACCGTCATGACTCGAGTCATGACGGTCAGCGTGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018949.1-878s1c1
Sequence:CCGGCGCGCATCGTCAACTACCTGACTCGAGTCAGGTAGTTGACGATGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018949.1-951s1c1
Sequence:CCGGGCTCACCAGGAACTACCGCGACTCGAGTCGCGGTAGTTCCTGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018949.1-255s1c1
Sequence:CCGGCATGTACGTCTACGTGGTCAACTCGAGTTGACCACGTAGACGTACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018949
VALIDATED
UTS2R MISSION shRNA shRNA Plasmid DNA
urotensin 2 receptor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018949.1-396s21c1
Sequence:CCGGGACCATGCACGCCAGCATCTTCTCGAGAAGATGCTGGCGTGCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018949.1-413s21c1
Sequence:CCGGTCTTCACGCTGACCGTCATGACTCGAGTCATGACGGTCAGCGTGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018949.1-878s1c1
Sequence:CCGGCGCGCATCGTCAACTACCTGACTCGAGTCAGGTAGTTGACGATGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018949.1-951s1c1
Sequence:CCGGGCTCACCAGGAACTACCGCGACTCGAGTCGCGGTAGTTCCTGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018949.1-255s1c1
Sequence:CCGGCATGTACGTCTACGTGGTCAACTCGAGTTGACCACGTAGACGTACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018949
VALIDATED
UTS2R MISSION shRNA Lentiviral Transduction Particles
urotensin 2 receptor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018949.1-396s21c1
Sequence:CCGGGACCATGCACGCCAGCATCTTCTCGAGAAGATGCTGGCGTGCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018949.1-413s21c1
Sequence:CCGGTCTTCACGCTGACCGTCATGACTCGAGTCATGACGGTCAGCGTGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018949.1-878s1c1
Sequence:CCGGCGCGCATCGTCAACTACCTGACTCGAGTCAGGTAGTTGACGATGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018949.1-951s1c1
Sequence:CCGGGCTCACCAGGAACTACCGCGACTCGAGTCGCGGTAGTTCCTGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018949.1-255s1c1
Sequence:CCGGCATGTACGTCTACGTGGTCAACTCGAGTTGACCACGTAGACGTACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks