EMAIL THIS PAGE TO A FRIEND

UTY

ubiquitously transcribed tetratricopeptide repeat containing, Y-linked

Synonyms: UTY1
Gene ID:
Human(7404) Summary: This gene encodes a protein containing tetratricopeptide repeats which are thought to be involved in protein-protein interactions. The encoded protein is also a minor histocompatibility antigen which may induce graft rejection of male stem cell grafts. A large number of alternatively spliced transcripts have been observed for this gene, but the full length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2012]
Mouse(22290) ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome
dog(100500941) tetratricopeptide repeat protein
cow(100271759) ubiquitously transcribed tetratricopeptide repeat gene, Y-linked
155 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007125 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009484 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009484 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009484 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007125 Rosetta Predictions human pricing
NM_182659 Rosetta Predictions human pricing
NM_182660 Rosetta Predictions human pricing
NM_009484 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129616 predicted 2610
2 SASI_Hs01_00129618 predicted 2894
3 SASI_Hs01_00129619 predicted 2860
4 SASI_Hs01_00129621 predicted 2972
5 SASI_Hs01_00129622 predicted 3088
6 SASI_Hs01_00129624 predicted 1536
7 SASI_Hs01_00129625 predicted 1335
8 SASI_Hs02_00343006 predicted 2871
9 SASI_Hs02_00343007 predicted 1409
10 SASI_Hs02_00343008 predicted 1962
11 SASI_Hs01_00129617 predicted 1562
12 SASI_Hs01_00129620 predicted 2798
13 SASI_Hs01_00129623 predicted 1729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148252 predicted 2610
2 SASI_Hs01_00148254 predicted 2887
3 SASI_Hs01_00148255 predicted 2859
4 SASI_Hs01_00148257 predicted 2974
5 SASI_Hs01_00148258 predicted 3085
6 SASI_Hs01_00148260 predicted 1530
7 SASI_Hs01_00148261 predicted 1332
8 SASI_Hs02_00370813 predicted 2867
9 SASI_Hs02_00370814 predicted 1403
10 SASI_Hs02_00370815 predicted 1961
11 SASI_Hs01_00148253 predicted 1571
12 SASI_Hs01_00148256 predicted 2798
13 SASI_Hs01_00148259 predicted 1723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245940 predicted 2613
2 SASI_Hs01_00245943 predicted 2886
3 SASI_Hs01_00245944 predicted 2853
4 SASI_Hs01_00245945 predicted 2968
5 SASI_Hs01_00245946 predicted 3090
6 SASI_Hs02_00370816 predicted 1721
7 SASI_Hs01_00245947 predicted 1530
8 SASI_Hs02_00370817 predicted 2703
9 SASI_Hs01_00245948 predicted 1331
10 SASI_Hs01_00245949 predicted 2865
11 SASI_Hs01_00245941 predicted 1568
12 SASI_Hs01_00245942 predicted 2406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162544 predicted 1992
2 SASI_Mm01_00162537 predicted 1539
3 SASI_Mm02_00316225 predicted 3689
4 SASI_Mm01_00162538 predicted 919
5 SASI_Mm01_00162540 predicted 3351
6 SASI_Mm01_00162541 predicted 478
7 SASI_Mm01_00162545 predicted 3205
8 SASI_Mm01_00162546 predicted 1869
9 SASI_Mm02_00316226 predicted 1622
10 SASI_Mm02_00316227 predicted 707
11 SASI_Mm01_00162539 predicted 893
12 SASI_Mm01_00162542 predicted 1218
13 SASI_Mm01_00162543 predicted 3423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007125
UTY MISSION shRNA Bacterial Glycerol Stock
ubiquitously transcribed tetratricopeptide repeat containing, Y-linked
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007125.3-2633s1c1
Sequence:CCGGGCAGTAATTGTATAGCAGGAACTCGAGTTCCTGCTATACAATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007125.3-2298s1c1
Sequence:CCGGGCGAGCAAATAGAGATAATTTCTCGAGAAATTATCTCTATTTGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007125.3-6148s1c1
Sequence:CCGGCCCATAAATAATTGCTGGAAACTCGAGTTTCCAGCAATTATTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007125.3-4559s1c1
Sequence:CCGGCCTGGAATGTTGGTCCACTTACTCGAGTAAGTGGACCAACATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007125.3-4225s1c1
Sequence:CCGGCTGGGCATGAATACAGTACAACTCGAGTTGTACTGTATTCATGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007125.3-3657s21c1
Sequence:CCGGTCCACCCACACCTAGTATTTACTCGAGTAAATACTAGGTGTGGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007125.3-4668s21c1
Sequence:GTACCGGCTGGAATATGGCACGAAATATCTCGAGATATTTCGTGCCATATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007125.3-2001s21c1
Sequence:GTACCGGGGATGCTTTACAGGCATATATCTCGAGATATATGCCTGTAAAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007125.3-2862s21c1
Sequence:CCGGGGCAACTAGCACTGGTATTAACTCGAGTTAATACCAGTGCTAGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007125.3-6136s21c1
Sequence:CCGGCCATAGTGATAGCCCATAAATCTCGAGATTTATGGGCTATCACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007125
UTY MISSION shRNA shRNA Plasmid DNA
ubiquitously transcribed tetratricopeptide repeat containing, Y-linked
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007125.3-2633s1c1
Sequence:CCGGGCAGTAATTGTATAGCAGGAACTCGAGTTCCTGCTATACAATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007125.3-2298s1c1
Sequence:CCGGGCGAGCAAATAGAGATAATTTCTCGAGAAATTATCTCTATTTGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007125.3-6148s1c1
Sequence:CCGGCCCATAAATAATTGCTGGAAACTCGAGTTTCCAGCAATTATTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007125.3-4559s1c1
Sequence:CCGGCCTGGAATGTTGGTCCACTTACTCGAGTAAGTGGACCAACATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007125.3-4225s1c1
Sequence:CCGGCTGGGCATGAATACAGTACAACTCGAGTTGTACTGTATTCATGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007125.3-3657s21c1
Sequence:CCGGTCCACCCACACCTAGTATTTACTCGAGTAAATACTAGGTGTGGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007125.3-4668s21c1
Sequence:GTACCGGCTGGAATATGGCACGAAATATCTCGAGATATTTCGTGCCATATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007125.3-2001s21c1
Sequence:GTACCGGGGATGCTTTACAGGCATATATCTCGAGATATATGCCTGTAAAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007125.3-2862s21c1
Sequence:CCGGGGCAACTAGCACTGGTATTAACTCGAGTTAATACCAGTGCTAGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007125.3-6136s21c1
Sequence:CCGGCCATAGTGATAGCCCATAAATCTCGAGATTTATGGGCTATCACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007125
UTY MISSION shRNA Lentiviral Transduction Particles
ubiquitously transcribed tetratricopeptide repeat containing, Y-linked
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007125.3-2633s1c1
Sequence:CCGGGCAGTAATTGTATAGCAGGAACTCGAGTTCCTGCTATACAATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007125.3-2298s1c1
Sequence:CCGGGCGAGCAAATAGAGATAATTTCTCGAGAAATTATCTCTATTTGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007125.3-6148s1c1
Sequence:CCGGCCCATAAATAATTGCTGGAAACTCGAGTTTCCAGCAATTATTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007125.3-4559s1c1
Sequence:CCGGCCTGGAATGTTGGTCCACTTACTCGAGTAAGTGGACCAACATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007125.3-4225s1c1
Sequence:CCGGCTGGGCATGAATACAGTACAACTCGAGTTGTACTGTATTCATGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007125.3-3657s21c1
Sequence:CCGGTCCACCCACACCTAGTATTTACTCGAGTAAATACTAGGTGTGGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007125.3-4668s21c1
Sequence:GTACCGGCTGGAATATGGCACGAAATATCTCGAGATATTTCGTGCCATATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007125.3-2001s21c1
Sequence:GTACCGGGGATGCTTTACAGGCATATATCTCGAGATATATGCCTGTAAAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007125.3-2862s21c1
Sequence:CCGGGGCAACTAGCACTGGTATTAACTCGAGTTAATACCAGTGCTAGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007125.3-6136s21c1
Sequence:CCGGCCATAGTGATAGCCCATAAATCTCGAGATTTATGGGCTATCACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009484
UTY MISSION shRNA Bacterial Glycerol Stock
ubiquitously transcribed tetratricopeptide repeat containing, Y-linked
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009484.1-3670s1c1
Sequence:CCGGGACTCTTTGCTAAAGCCAAATCTCGAGATTTGGCTTTAGCAAAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009484.1-809s1c1
Sequence:CCGGGCACCATAATATGGATCTAATCTCGAGATTAGATCCATATTATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009484.1-1113s1c1
Sequence:CCGGGCCTGGATGGACTTAGGTATTCTCGAGAATACCTAAGTCCATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009484.1-3579s1c1
Sequence:CCGGGCTGCCATCCTCGAATTTCATCTCGAGATGAAATTCGAGGATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009484.1-808s1c1
Sequence:CCGGTGCACCATAATATGGATCTAACTCGAGTTAGATCCATATTATGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009484
UTY MISSION shRNA shRNA Plasmid DNA
ubiquitously transcribed tetratricopeptide repeat containing, Y-linked
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009484.1-3670s1c1
Sequence:CCGGGACTCTTTGCTAAAGCCAAATCTCGAGATTTGGCTTTAGCAAAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009484.1-809s1c1
Sequence:CCGGGCACCATAATATGGATCTAATCTCGAGATTAGATCCATATTATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009484.1-1113s1c1
Sequence:CCGGGCCTGGATGGACTTAGGTATTCTCGAGAATACCTAAGTCCATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009484.1-3579s1c1
Sequence:CCGGGCTGCCATCCTCGAATTTCATCTCGAGATGAAATTCGAGGATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009484.1-808s1c1
Sequence:CCGGTGCACCATAATATGGATCTAACTCGAGTTAGATCCATATTATGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009484
UTY MISSION shRNA Lentiviral Transduction Particles
ubiquitously transcribed tetratricopeptide repeat containing, Y-linked
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009484.1-3670s1c1
Sequence:CCGGGACTCTTTGCTAAAGCCAAATCTCGAGATTTGGCTTTAGCAAAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009484.1-809s1c1
Sequence:CCGGGCACCATAATATGGATCTAATCTCGAGATTAGATCCATATTATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009484.1-1113s1c1
Sequence:CCGGGCCTGGATGGACTTAGGTATTCTCGAGAATACCTAAGTCCATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009484.1-3579s1c1
Sequence:CCGGGCTGCCATCCTCGAATTTCATCTCGAGATGAAATTCGAGGATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009484.1-808s1c1
Sequence:CCGGTGCACCATAATATGGATCTAACTCGAGTTAGATCCATATTATGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks