EMAIL THIS PAGE TO A FRIEND

UVRAG

UV radiation resistance associated

Synonyms: DHTX VPS38 p63
UniProtKB ID: Q9P2Y5, O00392
Gene ID:
Human(7405) Summary: This gene complements the ultraviolet sensitivity of xeroderma pigmentosum group C cells and encodes a protein with a C2 domain. The protein activates the Beclin1-PI(3)KC3 complex, promoting autophagy and suppressing the proliferation and tumorigenicity of human colon cancer cells. Chromosomal aberrations involving this gene are associated with left-right axis malformation and mutations in this gene have been associated with colon cancer. [provided by RefSeq, Jul 2008]
Mouse(78610) UV radiation resistance associated gene
Rat(308846) UV radiation resistance associated gene
fruit fly(34735) UV-resistance associated gene
Zebrafish(394044) UV radiation resistance associated gene
chicken(419091) UV radiation resistance associated gene
dog(607998) UV radiation resistance associated gene
domestic cat(101090891) UV radiation resistance associated gene
Horse(100051722) UV radiation resistance associated gene
cow(614285) UV radiation resistance associated gene
sheep(101108687) UV radiation resistance associated
domestic guinea pig(100718392) UV radiation resistance associated
naked mole-rat(101698331) UV radiation resistance associated
Domestic Rabbit(100354086) UV radiation resistance associated gene
185 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003369 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178635 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178635 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178635 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003369 Rosetta Predictions human pricing
NM_001107536 Rosetta Predictions rat pricing
NM_178635 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113688 predicted 1421
2 SASI_Hs01_00113689 predicted 1735
3 SASI_Hs01_00113690 predicted 489
4 SASI_Hs01_00113691 predicted 1160
5 SASI_Hs01_00113692 predicted 1939
6 SASI_Hs01_00113693 predicted 370
7 SASI_Hs01_00113694 predicted 2403
8 SASI_Hs01_00113695 predicted 1967
9 SASI_Hs01_00113696 predicted 1223
10 SASI_Hs01_00113697 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229795 predicted 1344
2 SASI_Rn02_00229796 predicted 429
3 SASI_Rn02_00229797 predicted 331
4 SASI_Rn02_00229798 predicted 981
5 SASI_Rn02_00229799 predicted 732
6 SASI_Rn02_00229800 predicted 1322
7 SASI_Rn02_00229801 predicted 464
8 SASI_Rn02_00229802 predicted 316
9 SASI_Rn02_00229803 predicted 1164
10 SASI_Rn02_00229804 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098063 predicted 337
2 SASI_Mm01_00098064 predicted 1159
3 SASI_Mm01_00098065 predicted 671
4 SASI_Mm01_00098066 predicted 375
5 SASI_Mm01_00098067 predicted 852
6 SASI_Mm01_00098068 predicted 1681
7 SASI_Mm01_00098069 predicted 757
8 SASI_Mm01_00098070 predicted 731
9 SASI_Mm02_00349022 predicted 1261
10 SASI_Mm01_00098071 predicted 1920
11 SASI_Mm01_00098072 predicted 1599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003369
VALIDATED
UVRAG MISSION shRNA Bacterial Glycerol Stock
UV radiation resistance associated
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003369.3-517s21c1
Sequence:CCGGCACGTGGCGAAGTCTCGATTTCTCGAGAAATCGAGACTTCGCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003369.3-735s21c1
Sequence:CCGGCATTTGAACATAAGGGTTATTCTCGAGAATAACCCTTATGTTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003369.3-420s21c1
Sequence:CCGGAGCTCCTTGATACCTACTTTACTCGAGTAAAGTAGGTATCAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003369.3-366s21c1
Sequence:CCGGTTCGACATCTTCGGAACATTGCTCGAGCAATGTTCCGAAGATGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003369.3-2403s21c1
Sequence:CCGGACTTAACCCTTTGTGATAATGCTCGAGCATTATCACAAAGGGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003369.3-1265s21c1
Sequence:CCGGTGCGGTGTCAAGTTGCCTAATCTCGAGATTAGGCAACTTGACACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003369.2-2637s1c1
Sequence:CCGGCCTTAGTTTCTCATAAGCATTCTCGAGAATGCTTATGAGAAACTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003369.2-327s1c1
Sequence:CCGGCCCGGAACATTGTTAATAGAACTCGAGTTCTATTAACAATGTTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003369.2-1438s1c1
Sequence:CCGGGCAGTTTGATTATGGTGTCTACTCGAGTAGACACCATAATCAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003369.2-1265s1c1
Sequence:CCGGGCCCTTGGTTATACTGCACATCTCGAGATGTGCAGTATAACCAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003369.2-1919s1c1
Sequence:CCGGCCTAGCCAAGAACAAGGAGAACTCGAGTTCTCCTTGTTCTTGGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003369
VALIDATED
UVRAG MISSION shRNA shRNA Plasmid DNA
UV radiation resistance associated
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003369.3-517s21c1
Sequence:CCGGCACGTGGCGAAGTCTCGATTTCTCGAGAAATCGAGACTTCGCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003369.3-735s21c1
Sequence:CCGGCATTTGAACATAAGGGTTATTCTCGAGAATAACCCTTATGTTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003369.3-420s21c1
Sequence:CCGGAGCTCCTTGATACCTACTTTACTCGAGTAAAGTAGGTATCAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003369.3-366s21c1
Sequence:CCGGTTCGACATCTTCGGAACATTGCTCGAGCAATGTTCCGAAGATGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003369.3-2403s21c1
Sequence:CCGGACTTAACCCTTTGTGATAATGCTCGAGCATTATCACAAAGGGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003369.3-1265s21c1
Sequence:CCGGTGCGGTGTCAAGTTGCCTAATCTCGAGATTAGGCAACTTGACACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003369.2-2637s1c1
Sequence:CCGGCCTTAGTTTCTCATAAGCATTCTCGAGAATGCTTATGAGAAACTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003369.2-327s1c1
Sequence:CCGGCCCGGAACATTGTTAATAGAACTCGAGTTCTATTAACAATGTTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003369.2-1438s1c1
Sequence:CCGGGCAGTTTGATTATGGTGTCTACTCGAGTAGACACCATAATCAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003369.2-1265s1c1
Sequence:CCGGGCCCTTGGTTATACTGCACATCTCGAGATGTGCAGTATAACCAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003369.2-1919s1c1
Sequence:CCGGCCTAGCCAAGAACAAGGAGAACTCGAGTTCTCCTTGTTCTTGGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003369
VALIDATED
UVRAG MISSION shRNA Lentiviral Transduction Particles
UV radiation resistance associated
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003369.3-517s21c1
Sequence:CCGGCACGTGGCGAAGTCTCGATTTCTCGAGAAATCGAGACTTCGCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003369.3-735s21c1
Sequence:CCGGCATTTGAACATAAGGGTTATTCTCGAGAATAACCCTTATGTTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003369.3-420s21c1
Sequence:CCGGAGCTCCTTGATACCTACTTTACTCGAGTAAAGTAGGTATCAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003369.3-366s21c1
Sequence:CCGGTTCGACATCTTCGGAACATTGCTCGAGCAATGTTCCGAAGATGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003369.3-2403s21c1
Sequence:CCGGACTTAACCCTTTGTGATAATGCTCGAGCATTATCACAAAGGGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003369.3-1265s21c1
Sequence:CCGGTGCGGTGTCAAGTTGCCTAATCTCGAGATTAGGCAACTTGACACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003369.2-2637s1c1
Sequence:CCGGCCTTAGTTTCTCATAAGCATTCTCGAGAATGCTTATGAGAAACTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003369.2-327s1c1
Sequence:CCGGCCCGGAACATTGTTAATAGAACTCGAGTTCTATTAACAATGTTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003369.2-1438s1c1
Sequence:CCGGGCAGTTTGATTATGGTGTCTACTCGAGTAGACACCATAATCAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003369.2-1265s1c1
Sequence:CCGGGCCCTTGGTTATACTGCACATCTCGAGATGTGCAGTATAACCAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003369.2-1919s1c1
Sequence:CCGGCCTAGCCAAGAACAAGGAGAACTCGAGTTCTCCTTGTTCTTGGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178635
VALIDATED
UVRAG MISSION shRNA Bacterial Glycerol Stock
UV radiation resistance associated
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178635.3-334s21c1
Sequence:CCGGACATCGCTGCTCGGAACATTGCTCGAGCAATGTTCCGAGCAGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178635.3-2563s21c1
Sequence:CCGGGGCATTTGTCTGCGGTTTATTCTCGAGAATAAACCGCAGACAAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178635.3-1190s21c1
Sequence:CCGGGAATGAGAACAAGGATTATTTCTCGAGAAATAATCCTTGTTCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178635.3-1156s21c1
Sequence:CCGGTCTCAGAGCTGTCCTACATTTCTCGAGAAATGTAGGACAGCTCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178635.3-636s21c1
Sequence:CCGGCGCAACCAGAATGAAATCATTCTCGAGAATGATTTCATTCTGGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178635.2-3061s1c1
Sequence:CCGGCCCTAGATATAAATCCTGTTACTCGAGTAACAGGATTTATATCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178635.2-1133s1c1
Sequence:CCGGCTGTCCTACATTTACCCTATTCTCGAGAATAGGGTAAATGTAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178635.2-1137s1c1
Sequence:CCGGCCTACATTTACCCTATTGATTCTCGAGAATCAATAGGGTAAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178635.2-1332s1c1
Sequence:CCGGCCAGATCAACAATCAAAGATACTCGAGTATCTTTGATTGTTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178635.2-605s1c1
Sequence:CCGGCGCAACCAGAATGAAATCATTCTCGAGAATGATTTCATTCTGGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178635
VALIDATED
UVRAG MISSION shRNA shRNA Plasmid DNA
UV radiation resistance associated
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178635.3-334s21c1
Sequence:CCGGACATCGCTGCTCGGAACATTGCTCGAGCAATGTTCCGAGCAGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178635.3-2563s21c1
Sequence:CCGGGGCATTTGTCTGCGGTTTATTCTCGAGAATAAACCGCAGACAAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178635.3-1190s21c1
Sequence:CCGGGAATGAGAACAAGGATTATTTCTCGAGAAATAATCCTTGTTCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178635.3-1156s21c1
Sequence:CCGGTCTCAGAGCTGTCCTACATTTCTCGAGAAATGTAGGACAGCTCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178635.3-636s21c1
Sequence:CCGGCGCAACCAGAATGAAATCATTCTCGAGAATGATTTCATTCTGGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178635.2-3061s1c1
Sequence:CCGGCCCTAGATATAAATCCTGTTACTCGAGTAACAGGATTTATATCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178635.2-1133s1c1
Sequence:CCGGCTGTCCTACATTTACCCTATTCTCGAGAATAGGGTAAATGTAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178635.2-1137s1c1
Sequence:CCGGCCTACATTTACCCTATTGATTCTCGAGAATCAATAGGGTAAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178635.2-1332s1c1
Sequence:CCGGCCAGATCAACAATCAAAGATACTCGAGTATCTTTGATTGTTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178635.2-605s1c1
Sequence:CCGGCGCAACCAGAATGAAATCATTCTCGAGAATGATTTCATTCTGGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178635
VALIDATED
UVRAG MISSION shRNA Lentiviral Transduction Particles
UV radiation resistance associated
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178635.3-334s21c1
Sequence:CCGGACATCGCTGCTCGGAACATTGCTCGAGCAATGTTCCGAGCAGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178635.3-2563s21c1
Sequence:CCGGGGCATTTGTCTGCGGTTTATTCTCGAGAATAAACCGCAGACAAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178635.3-1190s21c1
Sequence:CCGGGAATGAGAACAAGGATTATTTCTCGAGAAATAATCCTTGTTCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178635.3-1156s21c1
Sequence:CCGGTCTCAGAGCTGTCCTACATTTCTCGAGAAATGTAGGACAGCTCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178635.3-636s21c1
Sequence:CCGGCGCAACCAGAATGAAATCATTCTCGAGAATGATTTCATTCTGGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178635.2-3061s1c1
Sequence:CCGGCCCTAGATATAAATCCTGTTACTCGAGTAACAGGATTTATATCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178635.2-1133s1c1
Sequence:CCGGCTGTCCTACATTTACCCTATTCTCGAGAATAGGGTAAATGTAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178635.2-1137s1c1
Sequence:CCGGCCTACATTTACCCTATTGATTCTCGAGAATCAATAGGGTAAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178635.2-1332s1c1
Sequence:CCGGCCAGATCAACAATCAAAGATACTCGAGTATCTTTGATTGTTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178635.2-605s1c1
Sequence:CCGGCGCAACCAGAATGAAATCATTCTCGAGAATGATTTCATTCTGGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks