EMAIL THIS PAGE TO A FRIEND

UVSSA

UV-stimulated scaffold protein A

Synonyms: KIAA1530 UVSS3
UniProtKB ID: Q2YD98, A8K9E6, B2RU11, Q8WTX4, Q9P1Z8
Gene ID:
Human(57654) Summary: The protein encoded by this gene appears to be involved in ubiquitination and dephosphorylation of RNA polymerase II subunits that stall after UV irradiation. The encoded protein interacts with several members of the nucleotide excision repair complex to help repair UV-induced DNA damage. Defects in this gene can cause UV-sensitive syndrome 3. [provided by RefSeq, May 2012]
Mouse(71101) UV stimulated scaffold protein A
Rat(314061) UV-stimulated scaffold protein A
domestic guinea pig(100729331) UV-stimulated scaffold protein A
naked mole-rat(101719940) UV-stimulated scaffold protein A
Zebrafish(402864) UV-stimulated scaffold protein A
chicken(422903) UV-stimulated scaffold protein A
dog(488812) UV-stimulated scaffold protein A
domestic cat(101082148) UV-stimulated scaffold protein A
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020894 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081101 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081101 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081101 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020894 Rosetta Predictions human pricing
NM_001134558 Rosetta Predictions rat pricing
NM_001081101 Rosetta Predictions mouse pricing
XM_132005 Rosetta Predictions mouse pricing
XM_897937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167105 predicted 2502
2 SASI_Hs01_00167106 predicted 849
3 SASI_Hs01_00167107 predicted 2001
4 SASI_Hs01_00167108 predicted 846
5 SASI_Hs01_00167109 predicted 2658
6 SASI_Hs01_00167110 predicted 2544
7 SASI_Hs01_00167111 predicted 2315
8 SASI_Hs01_00167113 predicted 2672
9 SASI_Hs01_00167114 predicted 2598
10 SASI_Hs02_00354213 predicted 1536
11 SASI_Hs01_00167112 predicted 2679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257069 predicted 1790
2 SASI_Rn02_00257070 predicted 1731
3 SASI_Rn02_00257071 predicted 720
4 SASI_Rn02_00257072 predicted 2348
5 SASI_Rn02_00257073 predicted 1613
6 SASI_Rn02_00257074 predicted 2331
7 SASI_Rn02_00257075 predicted 452
8 SASI_Rn02_00257076 predicted 883
9 SASI_Rn02_00257077 predicted 1512
10 SASI_Rn02_00257078 predicted 1517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081101 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295191 predicted 2393
2 SASI_Mm02_00295192 predicted 1574
3 SASI_Mm02_00295193 predicted 926
4 SASI_Mm02_00295194 predicted 2083
5 SASI_Mm02_00295195 predicted 2419
6 SASI_Mm02_00295196 predicted 1214
7 SASI_Mm02_00295197 predicted 2182
8 SASI_Mm02_00295198 predicted 309
9 SASI_Mm02_00295199 predicted 683
10 SASI_Mm02_00295200 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132005 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225192 predicted 2391
2 SASI_Mm01_00225193 predicted 1588
3 SASI_Mm01_00225194 predicted 931
4 SASI_Mm01_00225195 predicted 2428
5 SASI_Mm01_00225196 predicted 1643
6 SASI_Mm01_00225197 predicted 1223
7 SASI_Mm01_00225198 predicted 2189
8 SASI_Mm01_00225199 predicted 323
9 SASI_Mm01_00225200 predicted 687
10 SASI_Mm01_00225201 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280117 predicted 1747
2 SASI_Mm01_00280118 predicted 2112
3 SASI_Mm01_00280119 predicted 1797
4 SASI_Mm01_00280120 predicted 1377
5 SASI_Mm01_00280121 predicted 2072
6 SASI_Mm01_00280122 predicted 472
7 SASI_Mm01_00280123 predicted 2115
8 SASI_Mm01_00280124 predicted 846
9 SASI_Mm01_00280125 predicted 1269
10 SASI_Mm01_00280126 predicted 2056
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020894
UVSSA MISSION shRNA Bacterial Glycerol Stock
UV-stimulated scaffold protein A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020894.1-2526s1c1
Sequence:CCGGCCAGAAGAAGCACGAGAAGTTCTCGAGAACTTCTCGTGCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020894.1-842s1c1
Sequence:CCGGCCTTGGGCTACCACTTCTTAACTCGAGTTAAGAAGTGGTAGCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020894.1-2203s1c1
Sequence:CCGGCCTTTCCATGGGAAGATTGTTCTCGAGAACAATCTTCCCATGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020894.1-1747s1c1
Sequence:CCGGGCACCAGAGAAAGACACAGTTCTCGAGAACTGTGTCTTTCTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168300    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020894.1-2659s1c1
Sequence:CCGGGCAGTAACCATGCTTTGTCTACTCGAGTAGACAAAGCATGGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020894.1-993s1c1
Sequence:CCGGGCAAGAAATGTCTGGAGAAATCTCGAGATTTCTCCAGACATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020894.1-2670s1c1
Sequence:CCGGGCTTTGTCTATTACTGTGTTTCTCGAGAAACACAGTAATAGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020894.2-3023s21c1
Sequence:CCGGACCGTTCAGTCATCTGCTTTCCTCGAGGAAAGCAGATGACTGAACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020894.2-1017s21c1
Sequence:CCGGATCCTGCTTGACGGAGGTAGACTCGAGTCTACCTCCGTCAAGCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020894.2-1347s21c1
Sequence:CCGGGCACAAGTACACGCTGGATGTCTCGAGACATCCAGCGTGTACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020894.2-1090s21c1
Sequence:CCGGGAATCCCTTGGCATGGCTTCTCTCGAGAGAAGCCATGCCAAGGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020894
UVSSA MISSION shRNA shRNA Plasmid DNA
UV-stimulated scaffold protein A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020894.1-2526s1c1
Sequence:CCGGCCAGAAGAAGCACGAGAAGTTCTCGAGAACTTCTCGTGCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020894.1-842s1c1
Sequence:CCGGCCTTGGGCTACCACTTCTTAACTCGAGTTAAGAAGTGGTAGCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020894.1-2203s1c1
Sequence:CCGGCCTTTCCATGGGAAGATTGTTCTCGAGAACAATCTTCCCATGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020894.1-1747s1c1
Sequence:CCGGGCACCAGAGAAAGACACAGTTCTCGAGAACTGTGTCTTTCTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168300    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020894.1-2659s1c1
Sequence:CCGGGCAGTAACCATGCTTTGTCTACTCGAGTAGACAAAGCATGGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020894.1-993s1c1
Sequence:CCGGGCAAGAAATGTCTGGAGAAATCTCGAGATTTCTCCAGACATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020894.1-2670s1c1
Sequence:CCGGGCTTTGTCTATTACTGTGTTTCTCGAGAAACACAGTAATAGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020894.2-3023s21c1
Sequence:CCGGACCGTTCAGTCATCTGCTTTCCTCGAGGAAAGCAGATGACTGAACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020894.2-1017s21c1
Sequence:CCGGATCCTGCTTGACGGAGGTAGACTCGAGTCTACCTCCGTCAAGCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020894.2-1347s21c1
Sequence:CCGGGCACAAGTACACGCTGGATGTCTCGAGACATCCAGCGTGTACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020894.2-1090s21c1
Sequence:CCGGGAATCCCTTGGCATGGCTTCTCTCGAGAGAAGCCATGCCAAGGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020894
UVSSA MISSION shRNA Lentiviral Transduction Particles
UV-stimulated scaffold protein A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020894.1-2526s1c1
Sequence:CCGGCCAGAAGAAGCACGAGAAGTTCTCGAGAACTTCTCGTGCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020894.1-842s1c1
Sequence:CCGGCCTTGGGCTACCACTTCTTAACTCGAGTTAAGAAGTGGTAGCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020894.1-2203s1c1
Sequence:CCGGCCTTTCCATGGGAAGATTGTTCTCGAGAACAATCTTCCCATGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020894.1-1747s1c1
Sequence:CCGGGCACCAGAGAAAGACACAGTTCTCGAGAACTGTGTCTTTCTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168300    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020894.1-2659s1c1
Sequence:CCGGGCAGTAACCATGCTTTGTCTACTCGAGTAGACAAAGCATGGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020894.1-993s1c1
Sequence:CCGGGCAAGAAATGTCTGGAGAAATCTCGAGATTTCTCCAGACATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020894.1-2670s1c1
Sequence:CCGGGCTTTGTCTATTACTGTGTTTCTCGAGAAACACAGTAATAGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020894.2-3023s21c1
Sequence:CCGGACCGTTCAGTCATCTGCTTTCCTCGAGGAAAGCAGATGACTGAACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020894.2-1017s21c1
Sequence:CCGGATCCTGCTTGACGGAGGTAGACTCGAGTCTACCTCCGTCAAGCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020894.2-1347s21c1
Sequence:CCGGGCACAAGTACACGCTGGATGTCTCGAGACATCCAGCGTGTACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020894.2-1090s21c1
Sequence:CCGGGAATCCCTTGGCATGGCTTCTCTCGAGAGAAGCCATGCCAAGGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081101
VALIDATED
UVSSA MISSION shRNA Bacterial Glycerol Stock
UV-stimulated scaffold protein A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081101.2-3944s21c1
Sequence:CCGGTACAACCTTTGGCCTATAATACTCGAGTATTATAGGCCAAAGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081101.2-1973s21c1
Sequence:CCGGTGCTCCATAGCCGACACATTACTCGAGTAATGTGTCGGCTATGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081101.2-2345s21c1
Sequence:CCGGGCCTTGAGAAGAAGGTCTTTGCTCGAGCAAAGACCTTCTTCTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081101.2-2427s21c1
Sequence:CCGGGAAGTTTGCAAACCAATTTAACTCGAGTTAAATTGGTTTGCAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081101.2-935s21c1
Sequence:CCGGTACCATGCCCAGAGGATAAATCTCGAGATTTATCCTCTGGGCATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081101
VALIDATED
UVSSA MISSION shRNA shRNA Plasmid DNA
UV-stimulated scaffold protein A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081101.2-3944s21c1
Sequence:CCGGTACAACCTTTGGCCTATAATACTCGAGTATTATAGGCCAAAGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081101.2-1973s21c1
Sequence:CCGGTGCTCCATAGCCGACACATTACTCGAGTAATGTGTCGGCTATGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081101.2-2345s21c1
Sequence:CCGGGCCTTGAGAAGAAGGTCTTTGCTCGAGCAAAGACCTTCTTCTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081101.2-2427s21c1
Sequence:CCGGGAAGTTTGCAAACCAATTTAACTCGAGTTAAATTGGTTTGCAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081101.2-935s21c1
Sequence:CCGGTACCATGCCCAGAGGATAAATCTCGAGATTTATCCTCTGGGCATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081101
VALIDATED
UVSSA MISSION shRNA Lentiviral Transduction Particles
UV-stimulated scaffold protein A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081101.2-3944s21c1
Sequence:CCGGTACAACCTTTGGCCTATAATACTCGAGTATTATAGGCCAAAGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081101.2-1973s21c1
Sequence:CCGGTGCTCCATAGCCGACACATTACTCGAGTAATGTGTCGGCTATGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081101.2-2345s21c1
Sequence:CCGGGCCTTGAGAAGAAGGTCTTTGCTCGAGCAAAGACCTTCTTCTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081101.2-2427s21c1
Sequence:CCGGGAAGTTTGCAAACCAATTTAACTCGAGTTAAATTGGTTTGCAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081101.2-935s21c1
Sequence:CCGGTACCATGCCCAGAGGATAAATCTCGAGATTTATCCTCTGGGCATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks