EMAIL THIS PAGE TO A FRIEND

UXS1

UDP-glucuronate decarboxylase 1

Synonyms: SDR6E1 UGD
UniProtKB ID: Q8NBZ7, Q8NBX3, Q9H5C2
Gene ID:
Human(80146) Summary: This gene encodes an enyzme found in the perinuclear Golgi which catalyzes the synthesis of UDP-xylose used in glycosaminoglycan (GAG) synthesis on proteoglycans. The GAG chains are covalently attached to proteoglycans which participate in signaling pathways during development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(67883) UDP-glucuronate decarboxylase 1
Rat(246232) UDP-glucuronate decarboxylase 1
cow(534788) UDP-glucuronate decarboxylase 1
sheep(101107778) UDP-glucuronate decarboxylase 1
naked mole-rat(101721577) UDP-glucuronate decarboxylase 1
domestic guinea pig(100728533) UDP-glucuronate decarboxylase 1
Thale Cress(824520) UDP-glucuronic acid decarboxylase 1
Zebrafish(192315) UDP-glucuronic acid decarboxylase 1
Horse(100054871) UDP-glucuronate decarboxylase 1
domestic cat(101099113) UDP-glucuronate decarboxylase 1
dog(481318) UDP-glucuronate decarboxylase 1
chicken(418728) UDP-glucuronate decarboxylase 1
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026430 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026430 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026430 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025076 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025076 Rosetta Predictions human pricing
NM_139336 Rosetta Predictions rat pricing
NM_026430 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357753 predicted 589
2 SASI_Hs02_00357754 predicted 627
3 SASI_Hs01_00194394 predicted 318
4 SASI_Hs01_00194395 predicted 402
5 SASI_Hs01_00194397 predicted 1087
6 SASI_Hs01_00194398 predicted 627
7 SASI_Hs01_00194399 predicted 559
8 SASI_Hs02_00357755 predicted 493
9 SASI_Hs01_00194400 predicted 497
10 SASI_Hs01_00194401 predicted 1029
11 SASI_Hs01_00194393 predicted 712
12 SASI_Hs01_00194396 predicted 611
13 SASI_Hs01_00194402 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083620 predicted 483
2 SASI_Rn01_00083621 predicted 753
3 SASI_Rn01_00083622 predicted 1036
4 SASI_Rn01_00083623 predicted 586
5 SASI_Rn02_00268597 predicted 259
6 SASI_Rn01_00083625 predicted 334
7 SASI_Rn01_00083626 predicted 211
8 SASI_Rn01_00083627 predicted 461
9 SASI_Rn01_00083628 predicted 469
10 SASI_Rn01_00083629 predicted 508
11 SASI_Rn01_00083624 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200710 predicted 541
2 SASI_Mm01_00200711 predicted 310
3 SASI_Mm01_00200712 predicted 457
4 SASI_Mm01_00200713 predicted 686
5 SASI_Mm01_00200714 predicted 996
6 SASI_Mm02_00330246 predicted 449
7 SASI_Mm01_00200715 predicted 293
8 SASI_Mm01_00200716 predicted 493
9 SASI_Mm02_00330247 predicted 992
10 SASI_Mm02_00330248 predicted 515
11 SASI_Mm01_00200717 predicted 219
12 SASI_Mm01_00200718 predicted 816
13 SASI_Mm01_00200719 predicted 212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026430
VALIDATED
UXS1 MISSION shRNA Bacterial Glycerol Stock
UDP-glucuronate decarboxylase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026430.3-766s21c1
Sequence:CCGGGCAAGGATCTTCAACACCTTTCTCGAGAAAGGTGTTGAAGATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026430.3-995s21c1
Sequence:CCGGTGGAATTTGCTCAGTTAATTACTCGAGTAATTAACTGAGCAAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026430.3-902s21c1
Sequence:CCGGACGTAAGTGATCTGGTGAATGCTCGAGCATTCACCAGATCACTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026430.3-788s21c1
Sequence:CCGGGGCCGAGAATGCACATGAATGCTCGAGCATTCATGTGCATTCTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026430.3-153s21c1
Sequence:CCGGCGAAAGCAAGATTGAAGAGATCTCGAGATCTCTTCAATCTTGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026430.1-2066s1c1
Sequence:CCGGGCTGAGAAGAACACTTGAGATCTCGAGATCTCAAGTGTTCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026430.1-199s1c1
Sequence:CCGGCGAAAGCAAGATTGAAGAGATCTCGAGATCTCTTCAATCTTGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026430.1-200s1c1
Sequence:CCGGGAAAGCAAGATTGAAGAGATTCTCGAGAATCTCTTCAATCTTGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026430.1-1237s1c1
Sequence:CCGGCCAGGCTAATAACCAGTACATCTCGAGATGTACTGGTTATTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026430.1-812s1c1
Sequence:CCGGGCAAGGATCTTCAACACCTTTCTCGAGAAAGGTGTTGAAGATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026430
VALIDATED
UXS1 MISSION shRNA shRNA Plasmid DNA
UDP-glucuronate decarboxylase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026430.3-766s21c1
Sequence:CCGGGCAAGGATCTTCAACACCTTTCTCGAGAAAGGTGTTGAAGATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026430.3-995s21c1
Sequence:CCGGTGGAATTTGCTCAGTTAATTACTCGAGTAATTAACTGAGCAAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026430.3-902s21c1
Sequence:CCGGACGTAAGTGATCTGGTGAATGCTCGAGCATTCACCAGATCACTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026430.3-788s21c1
Sequence:CCGGGGCCGAGAATGCACATGAATGCTCGAGCATTCATGTGCATTCTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026430.3-153s21c1
Sequence:CCGGCGAAAGCAAGATTGAAGAGATCTCGAGATCTCTTCAATCTTGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026430.1-2066s1c1
Sequence:CCGGGCTGAGAAGAACACTTGAGATCTCGAGATCTCAAGTGTTCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026430.1-199s1c1
Sequence:CCGGCGAAAGCAAGATTGAAGAGATCTCGAGATCTCTTCAATCTTGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026430.1-200s1c1
Sequence:CCGGGAAAGCAAGATTGAAGAGATTCTCGAGAATCTCTTCAATCTTGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026430.1-1237s1c1
Sequence:CCGGCCAGGCTAATAACCAGTACATCTCGAGATGTACTGGTTATTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026430.1-812s1c1
Sequence:CCGGGCAAGGATCTTCAACACCTTTCTCGAGAAAGGTGTTGAAGATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026430
VALIDATED
UXS1 MISSION shRNA Lentiviral Transduction Particles
UDP-glucuronate decarboxylase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026430.3-766s21c1
Sequence:CCGGGCAAGGATCTTCAACACCTTTCTCGAGAAAGGTGTTGAAGATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026430.3-995s21c1
Sequence:CCGGTGGAATTTGCTCAGTTAATTACTCGAGTAATTAACTGAGCAAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026430.3-902s21c1
Sequence:CCGGACGTAAGTGATCTGGTGAATGCTCGAGCATTCACCAGATCACTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026430.3-788s21c1
Sequence:CCGGGGCCGAGAATGCACATGAATGCTCGAGCATTCATGTGCATTCTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026430.3-153s21c1
Sequence:CCGGCGAAAGCAAGATTGAAGAGATCTCGAGATCTCTTCAATCTTGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026430.1-2066s1c1
Sequence:CCGGGCTGAGAAGAACACTTGAGATCTCGAGATCTCAAGTGTTCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026430.1-199s1c1
Sequence:CCGGCGAAAGCAAGATTGAAGAGATCTCGAGATCTCTTCAATCTTGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026430.1-200s1c1
Sequence:CCGGGAAAGCAAGATTGAAGAGATTCTCGAGAATCTCTTCAATCTTGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026430.1-1237s1c1
Sequence:CCGGCCAGGCTAATAACCAGTACATCTCGAGATGTACTGGTTATTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026430.1-812s1c1
Sequence:CCGGGCAAGGATCTTCAACACCTTTCTCGAGAAAGGTGTTGAAGATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025076
VALIDATED
UXS1 MISSION shRNA Bacterial Glycerol Stock
UDP-glucuronate decarboxylase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025076.3-1492s21c1
Sequence:CCGGGCTTGCTTTAATGAAATGGATCTCGAGATCCATTTCATTAAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025076.3-1289s21c1
Sequence:CCGGCCAGGCAAATAATCAGTACATCTCGAGATGTACTGATTATTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025076.3-319s21c1
Sequence:CCGGCCCAGAAATACCCACCAGTAACTCGAGTTACTGGTGGGTATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025076.3-591s21c1
Sequence:CCGGCCTCCAAACTACATGTATAATCTCGAGATTATACATGTAGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_025076.3-731s21c1
Sequence:CCGGCCACCCTCAAAGTGAGGATTACTCGAGTAATCCTCACTTTGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025076.2-1492s1c1
Sequence:CCGGGCTTGCTTTAATGAAATGGATCTCGAGATCCATTTCATTAAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025076.2-731s1c1
Sequence:CCGGCCACCCTCAAAGTGAGGATTACTCGAGTAATCCTCACTTTGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025076.2-1289s1c1
Sequence:CCGGCCAGGCAAATAATCAGTACATCTCGAGATGTACTGATTATTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025076.2-319s1c1
Sequence:CCGGCCCAGAAATACCCACCAGTAACTCGAGTTACTGGTGGGTATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025076.2-591s1c1
Sequence:CCGGCCTCCAAACTACATGTATAATCTCGAGATTATACATGTAGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025076
VALIDATED
UXS1 MISSION shRNA shRNA Plasmid DNA
UDP-glucuronate decarboxylase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025076.3-1492s21c1
Sequence:CCGGGCTTGCTTTAATGAAATGGATCTCGAGATCCATTTCATTAAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025076.3-1289s21c1
Sequence:CCGGCCAGGCAAATAATCAGTACATCTCGAGATGTACTGATTATTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025076.3-319s21c1
Sequence:CCGGCCCAGAAATACCCACCAGTAACTCGAGTTACTGGTGGGTATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025076.3-591s21c1
Sequence:CCGGCCTCCAAACTACATGTATAATCTCGAGATTATACATGTAGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_025076.3-731s21c1
Sequence:CCGGCCACCCTCAAAGTGAGGATTACTCGAGTAATCCTCACTTTGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025076.2-1492s1c1
Sequence:CCGGGCTTGCTTTAATGAAATGGATCTCGAGATCCATTTCATTAAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025076.2-731s1c1
Sequence:CCGGCCACCCTCAAAGTGAGGATTACTCGAGTAATCCTCACTTTGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025076.2-1289s1c1
Sequence:CCGGCCAGGCAAATAATCAGTACATCTCGAGATGTACTGATTATTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025076.2-319s1c1
Sequence:CCGGCCCAGAAATACCCACCAGTAACTCGAGTTACTGGTGGGTATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025076.2-591s1c1
Sequence:CCGGCCTCCAAACTACATGTATAATCTCGAGATTATACATGTAGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025076
VALIDATED
UXS1 MISSION shRNA Lentiviral Transduction Particles
UDP-glucuronate decarboxylase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025076.3-1492s21c1
Sequence:CCGGGCTTGCTTTAATGAAATGGATCTCGAGATCCATTTCATTAAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025076.3-1289s21c1
Sequence:CCGGCCAGGCAAATAATCAGTACATCTCGAGATGTACTGATTATTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025076.3-319s21c1
Sequence:CCGGCCCAGAAATACCCACCAGTAACTCGAGTTACTGGTGGGTATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025076.3-591s21c1
Sequence:CCGGCCTCCAAACTACATGTATAATCTCGAGATTATACATGTAGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_025076.3-731s21c1
Sequence:CCGGCCACCCTCAAAGTGAGGATTACTCGAGTAATCCTCACTTTGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025076.2-1492s1c1
Sequence:CCGGGCTTGCTTTAATGAAATGGATCTCGAGATCCATTTCATTAAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025076.2-731s1c1
Sequence:CCGGCCACCCTCAAAGTGAGGATTACTCGAGTAATCCTCACTTTGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025076.2-1289s1c1
Sequence:CCGGCCAGGCAAATAATCAGTACATCTCGAGATGTACTGATTATTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025076.2-319s1c1
Sequence:CCGGCCCAGAAATACCCACCAGTAACTCGAGTTACTGGTGGGTATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025076.2-591s1c1
Sequence:CCGGCCTCCAAACTACATGTATAATCTCGAGATTATACATGTAGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks