EMAIL THIS PAGE TO A FRIEND

UXT

ubiquitously-expressed, prefoldin-like chaperone

Synonyms: ART-27 STAP1
UniProtKB ID: Q9UBK9, B2R561, Q5JZG3, Q9Y6E5
Gene ID:
Human(8409) Summary: The protein encoded by this gene functions as a cofactor that modulates androgen receptor-dependent transcription, and also plays a critical role in tumor necrosis factor-induced apoptosis. Expression of this gene may play a role in tumorigenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Mouse(22294) ubiquitously expressed transcript
Rat(299313) ubiquitously-expressed, prefoldin-like chaperone
Zebrafish(447933) ubiquitously-expressed transcript
dog(480900) ubiquitously-expressed, prefoldin-like chaperone
domestic cat(101095641) ubiquitously-expressed, prefoldin-like chaperone
domestic guinea pig(101787727) ubiquitously-expressed, prefoldin-like chaperone
naked mole-rat(101725948) ubiquitously-expressed, prefoldin-like chaperone
cow(525680) ubiquitously-expressed transcript
sheep(101114935) ubiquitously-expressed, prefoldin-like chaperone
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004182 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004182 Rosetta Predictions human pricing
NM_153477 Rosetta Predictions human pricing
NM_001006982 Rosetta Predictions rat pricing
NM_013840 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337064 predicted 324
2 SASI_Hs01_00196080 predicted 299
3 SASI_Hs01_00196082 predicted 264
4 SASI_Hs01_00196083 predicted 270
5 SASI_Hs02_00337065 predicted 291
6 SASI_Hs01_00196084 predicted 261
7 SASI_Hs01_00196085 predicted 249
8 SASI_Hs01_00196086 predicted 304
9 SASI_Hs01_00196087 predicted 304
10 SASI_Hs01_00196088 predicted 263
11 SASI_Hs01_00196081 predicted 273
12 SASI_Hs01_00196089 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367302 predicted 458
2 SASI_Hs01_00233261 predicted 433
3 SASI_Hs01_00233263 predicted 398
4 SASI_Hs01_00233264 predicted 407
5 SASI_Hs02_00367303 predicted 427
6 SASI_Hs01_00233265 predicted 392
7 SASI_Hs01_00233266 predicted 375
8 SASI_Hs01_00233267 predicted 437
9 SASI_Hs01_00233268 predicted 432
10 SASI_Hs01_00233269 predicted 395
11 SASI_Hs01_00233262 predicted 412
12 SASI_Hs01_00233270 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093900 predicted 226
2 SASI_Rn02_00198553 predicted 211
3 SASI_Rn01_00093901 predicted 209
4 SASI_Rn01_00093902 predicted 245
5 SASI_Rn01_00093903 predicted 225
6 SASI_Rn01_00093904 predicted 254
7 SASI_Rn01_00093905 predicted 253
8 SASI_Rn01_00093906 predicted 192
9 SASI_Rn01_00093907 predicted 212
10 SASI_Rn01_00093908 predicted 246
11 SASI_Rn01_00093899 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148261 predicted 420
2 SASI_Mm01_00148262 predicted 232
3 SASI_Mm01_00148263 predicted 268
4 SASI_Mm01_00148264 predicted 446
5 SASI_Mm01_00148266 predicted 469
6 SASI_Mm01_00148259 predicted 584
7 SASI_Mm01_00148267 predicted 530
8 SASI_Mm02_00322838 predicted 299
9 SASI_Mm01_00148260 predicted 562
10 SASI_Mm02_00322839 predicted 258
11 SASI_Mm01_00148258 predicted 598
12 SASI_Mm01_00148265 predicted 466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004182
VALIDATED
UXT MISSION shRNA Bacterial Glycerol Stock
ubiquitously-expressed, prefoldin-like chaperone
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004182.2-306s1c1
Sequence:CCGGCCAGATACTTCACGCATCTATCTCGAGATAGATGCGTGAAGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004182.2-277s1c1
Sequence:CCGGGCTGTAACTTCTTCGTTGACACTCGAGTGTCAACGAAGAAGTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004182.2-203s1c1
Sequence:CCGGCCTTCAACTGAGAAATGTCATCTCGAGATGACATTTCTCAGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004182.2-369s1c1
Sequence:CCGGGAAGCTCTCAAGTTCATTGATCTCGAGATCAATGAACTTGAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004182.2-240s1c1
Sequence:CCGGGCTAAGCACTCGGAGTTATATCTCGAGATATAACTCCGAGTGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004182.2-189s1c1
Sequence:CCGGCAGCTGGCCAAATACCTTCAACTCGAGTTGAAGGTATTTGGCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004182.2-305s1c1
Sequence:CCGGCCCAGATACTTCACGCATCTACTCGAGTAGATGCGTGAAGTATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004182
VALIDATED
UXT MISSION shRNA shRNA Plasmid DNA
ubiquitously-expressed, prefoldin-like chaperone
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004182.2-306s1c1
Sequence:CCGGCCAGATACTTCACGCATCTATCTCGAGATAGATGCGTGAAGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004182.2-277s1c1
Sequence:CCGGGCTGTAACTTCTTCGTTGACACTCGAGTGTCAACGAAGAAGTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004182.2-203s1c1
Sequence:CCGGCCTTCAACTGAGAAATGTCATCTCGAGATGACATTTCTCAGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004182.2-369s1c1
Sequence:CCGGGAAGCTCTCAAGTTCATTGATCTCGAGATCAATGAACTTGAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004182.2-240s1c1
Sequence:CCGGGCTAAGCACTCGGAGTTATATCTCGAGATATAACTCCGAGTGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004182.2-189s1c1
Sequence:CCGGCAGCTGGCCAAATACCTTCAACTCGAGTTGAAGGTATTTGGCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004182.2-305s1c1
Sequence:CCGGCCCAGATACTTCACGCATCTACTCGAGTAGATGCGTGAAGTATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004182
VALIDATED
UXT MISSION shRNA Lentiviral Transduction Particles
ubiquitously-expressed, prefoldin-like chaperone
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004182.2-306s1c1
Sequence:CCGGCCAGATACTTCACGCATCTATCTCGAGATAGATGCGTGAAGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004182.2-277s1c1
Sequence:CCGGGCTGTAACTTCTTCGTTGACACTCGAGTGTCAACGAAGAAGTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004182.2-203s1c1
Sequence:CCGGCCTTCAACTGAGAAATGTCATCTCGAGATGACATTTCTCAGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004182.2-369s1c1
Sequence:CCGGGAAGCTCTCAAGTTCATTGATCTCGAGATCAATGAACTTGAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004182.2-240s1c1
Sequence:CCGGGCTAAGCACTCGGAGTTATATCTCGAGATATAACTCCGAGTGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004182.2-189s1c1
Sequence:CCGGCAGCTGGCCAAATACCTTCAACTCGAGTTGAAGGTATTTGGCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004182.2-305s1c1
Sequence:CCGGCCCAGATACTTCACGCATCTACTCGAGTAGATGCGTGAAGTATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013840
VALIDATED
UXT MISSION shRNA Bacterial Glycerol Stock
ubiquitously-expressed, prefoldin-like chaperone
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013840.2-569s1c1
Sequence:CCGGCCTTGGAATCACATAGTCCTTCTCGAGAAGGACTATGTGATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013840.2-304s1c1
Sequence:CCGGCCCAGATACTTCACGCATCTACTCGAGTAGATGCGTGAAGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013840.2-195s1c1
Sequence:CCGGCCGTATATCTTCAACTAAGAACTCGAGTTCTTAGTTGAAGATATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013840.2-438s1c1
Sequence:CCGGCCATGAATATCAAGGCCCATACTCGAGTATGGGCCTTGATATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013840.2-192s1c1
Sequence:CCGGTGTCCGTATATCTTCAACTAACTCGAGTTAGTTGAAGATATACGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013840.3-591s21c1
Sequence:CCGGTTCCCTAATTCTCACTAATTTCTCGAGAAATTAGTGAGAATTAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013840.3-194s21c1
Sequence:CCGGCCGTATATCTTCAACTAAGAACTCGAGTTCTTAGTTGAAGATATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013840.3-238s21c1
Sequence:CCGGACTAATCACTCGGAGTTATATCTCGAGATATAACTCCGAGTGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013840.3-437s21c1
Sequence:CCGGCCATGAATATCAAGGCCCATACTCGAGTATGGGCCTTGATATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013840.3-303s21c1
Sequence:CCGGCCCAGATACTTCACGCATCTACTCGAGTAGATGCGTGAAGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013840
VALIDATED
UXT MISSION shRNA shRNA Plasmid DNA
ubiquitously-expressed, prefoldin-like chaperone
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013840.2-569s1c1
Sequence:CCGGCCTTGGAATCACATAGTCCTTCTCGAGAAGGACTATGTGATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013840.2-304s1c1
Sequence:CCGGCCCAGATACTTCACGCATCTACTCGAGTAGATGCGTGAAGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013840.2-195s1c1
Sequence:CCGGCCGTATATCTTCAACTAAGAACTCGAGTTCTTAGTTGAAGATATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013840.2-438s1c1
Sequence:CCGGCCATGAATATCAAGGCCCATACTCGAGTATGGGCCTTGATATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013840.2-192s1c1
Sequence:CCGGTGTCCGTATATCTTCAACTAACTCGAGTTAGTTGAAGATATACGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013840.3-591s21c1
Sequence:CCGGTTCCCTAATTCTCACTAATTTCTCGAGAAATTAGTGAGAATTAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013840.3-194s21c1
Sequence:CCGGCCGTATATCTTCAACTAAGAACTCGAGTTCTTAGTTGAAGATATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013840.3-238s21c1
Sequence:CCGGACTAATCACTCGGAGTTATATCTCGAGATATAACTCCGAGTGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013840.3-437s21c1
Sequence:CCGGCCATGAATATCAAGGCCCATACTCGAGTATGGGCCTTGATATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013840.3-303s21c1
Sequence:CCGGCCCAGATACTTCACGCATCTACTCGAGTAGATGCGTGAAGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013840
VALIDATED
UXT MISSION shRNA Lentiviral Transduction Particles
ubiquitously-expressed, prefoldin-like chaperone
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013840.2-569s1c1
Sequence:CCGGCCTTGGAATCACATAGTCCTTCTCGAGAAGGACTATGTGATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013840.2-304s1c1
Sequence:CCGGCCCAGATACTTCACGCATCTACTCGAGTAGATGCGTGAAGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013840.2-195s1c1
Sequence:CCGGCCGTATATCTTCAACTAAGAACTCGAGTTCTTAGTTGAAGATATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013840.2-438s1c1
Sequence:CCGGCCATGAATATCAAGGCCCATACTCGAGTATGGGCCTTGATATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013840.2-192s1c1
Sequence:CCGGTGTCCGTATATCTTCAACTAACTCGAGTTAGTTGAAGATATACGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013840.3-591s21c1
Sequence:CCGGTTCCCTAATTCTCACTAATTTCTCGAGAAATTAGTGAGAATTAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013840.3-194s21c1
Sequence:CCGGCCGTATATCTTCAACTAAGAACTCGAGTTCTTAGTTGAAGATATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013840.3-238s21c1
Sequence:CCGGACTAATCACTCGGAGTTATATCTCGAGATATAACTCCGAGTGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013840.3-437s21c1
Sequence:CCGGCCATGAATATCAAGGCCCATACTCGAGTATGGGCCTTGATATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013840.3-303s21c1
Sequence:CCGGCCCAGATACTTCACGCATCTACTCGAGTAGATGCGTGAAGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks