EMAIL THIS PAGE TO A FRIEND

VAC14

Vac14 homolog (S. cerevisiae)

Synonyms: ArPIKfyve TAX1BP2 TRX
Gene ID:
Human(55697) Summary: The content of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) in endosomal membranes changes dynamically with fission and fusion events that generate or absorb intracellular transport vesicles. VAC14 is a component of a trimolecular complex that tightly regulates the level of PtdIns(3,5)P2. Other components of this complex are the PtdIns(3,5)P2-synthesizing enzyme PIKFYVE (MIM 609414) and the PtdIns(3,5)P2 phosphatase FIG4 (MIM 609390). VAC14 functions as an activator of PIKFYVE (Sbrissa et al., 2007 [PubMed 17556371]
Mouse(234729) Vac14 homolog (S. cerevisiae)
Rat(307842) Vac14 homolog (S. cerevisiae)
Zebrafish(447912) vac14 homolog (S. cerevisiae)
Horse(100054657) Vac14 homolog (S. cerevisiae)
domestic cat(101093908) Vac14 homolog (S. cerevisiae)
chicken(415678) Vac14 homolog (S. cerevisiae)
dog(489717) Vac14 homolog (S. cerevisiae)
cow(533202) Vac14 homolog (S. cerevisiae)
sheep(101114132) Vac14 homolog (S. cerevisiae)
domestic guinea pig(100726301) Vac14 homolog (S. cerevisiae)
naked mole-rat(101725753) Vac14 homolog (S. cerevisiae)
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018052 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018052 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018052 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146216 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146216 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146216 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018052 Rosetta Predictions human pricing
NM_177930 Rosetta Predictions rat pricing
NM_146216 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226999 predicted 1846
2 SASI_Hs01_00227000 predicted 1464
3 SASI_Hs01_00227001 predicted 799
4 SASI_Hs01_00227002 predicted 785
5 SASI_Hs01_00227004 predicted 1984
6 SASI_Hs01_00227005 predicted 1603
7 SASI_Hs01_00227006 predicted 1585
8 SASI_Hs01_00227007 predicted 1182
9 SASI_Hs01_00227008 predicted 2177
10 SASI_Hs02_00351186 predicted 818
11 SASI_Hs01_00227003 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177930 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047504 predicted 1100
2 SASI_Rn01_00047505 predicted 1151
3 SASI_Rn02_00269591 predicted 1092
4 SASI_Rn01_00047506 predicted 334
5 SASI_Rn01_00047507 predicted 1583
6 SASI_Rn01_00047509 predicted 1797
7 SASI_Rn01_00047510 predicted 1637
8 SASI_Rn01_00047511 predicted 1987
9 SASI_Rn02_00269592 predicted 1649
10 SASI_Rn02_00269593 predicted 2625
11 SASI_Rn01_00047503 predicted 1060
12 SASI_Rn01_00047508 predicted 2706
13 SASI_Rn01_00047512 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073146 predicted 1067
2 SASI_Mm01_00073147 predicted 1587
3 SASI_Mm01_00073148 predicted 1119
4 SASI_Mm01_00073149 predicted 302
5 SASI_Mm02_00341916 predicted 581
6 SASI_Mm01_00073150 predicted 1548
7 SASI_Mm01_00073151 predicted 370
8 SASI_Mm01_00073152 predicted 2589
9 SASI_Mm01_00073153 predicted 2580
10 SASI_Mm01_00073154 predicted 1440
11 SASI_Mm01_00073155 predicted 1991
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018052
VALIDATED
VAC14 MISSION shRNA Bacterial Glycerol Stock
Vac14 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018052.3-2868s1c1
Sequence:CCGGCCACTCATCCTCTGGAATCAACTCGAGTTGATTCCAGAGGATGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018052.3-2892s1c1
Sequence:CCGGCTTTCTAATACCCTCTTGGAACTCGAGTTCCAAGAGGGTATTAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018052.3-310s1c1
Sequence:CCGGCTCAATGACAAGCTGTACGAACTCGAGTTCGTACAGCTTGTCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018052.3-1014s1c1
Sequence:CCGGCAGTGTGAAGTTTGCTGAGATCTCGAGATCTCAGCAAACTTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018052.3-396s1c1
Sequence:CCGGCGTGCAAATCAAGCATGTGATCTCGAGATCACATGCTTGATTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018052.3-2944s1c1
Sequence:CCGGGCTCTGGCCTTGTGTGTATATCTCGAGATATACACACAAGGCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018052.3-560s1c1
Sequence:CCGGGCTTCAATGATGCAGACAGCACTCGAGTGCTGTCTGCATCATTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018052.3-1592s21c1
Sequence:CCGGCCATCCTACTGCAGACGTTATCTCGAGATAACGTCTGCAGTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018052.3-793s21c1
Sequence:CCGGTTGTTGCGAGAGAGGATTTACCTCGAGGTAAATCCTCTCTCGCAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018052.3-923s21c1
Sequence:CCGGTCCAGATCCTGGGTGACAATGCTCGAGCATTGTCACCCAGGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018052.3-2637s21c1
Sequence:CCGGGTGGTCCCATGAAACACTAAGCTCGAGCTTAGTGTTTCATGGGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018052.3-396s21c1
Sequence:CCGGCGTGCAAATCAAGCATGTGATCTCGAGATCACATGCTTGATTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018052
VALIDATED
VAC14 MISSION shRNA shRNA Plasmid DNA
Vac14 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018052.3-2868s1c1
Sequence:CCGGCCACTCATCCTCTGGAATCAACTCGAGTTGATTCCAGAGGATGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018052.3-2892s1c1
Sequence:CCGGCTTTCTAATACCCTCTTGGAACTCGAGTTCCAAGAGGGTATTAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018052.3-310s1c1
Sequence:CCGGCTCAATGACAAGCTGTACGAACTCGAGTTCGTACAGCTTGTCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018052.3-1014s1c1
Sequence:CCGGCAGTGTGAAGTTTGCTGAGATCTCGAGATCTCAGCAAACTTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018052.3-396s1c1
Sequence:CCGGCGTGCAAATCAAGCATGTGATCTCGAGATCACATGCTTGATTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018052.3-2944s1c1
Sequence:CCGGGCTCTGGCCTTGTGTGTATATCTCGAGATATACACACAAGGCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018052.3-560s1c1
Sequence:CCGGGCTTCAATGATGCAGACAGCACTCGAGTGCTGTCTGCATCATTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018052.3-1592s21c1
Sequence:CCGGCCATCCTACTGCAGACGTTATCTCGAGATAACGTCTGCAGTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018052.3-793s21c1
Sequence:CCGGTTGTTGCGAGAGAGGATTTACCTCGAGGTAAATCCTCTCTCGCAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018052.3-923s21c1
Sequence:CCGGTCCAGATCCTGGGTGACAATGCTCGAGCATTGTCACCCAGGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018052.3-2637s21c1
Sequence:CCGGGTGGTCCCATGAAACACTAAGCTCGAGCTTAGTGTTTCATGGGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018052.3-396s21c1
Sequence:CCGGCGTGCAAATCAAGCATGTGATCTCGAGATCACATGCTTGATTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018052
VALIDATED
VAC14 MISSION shRNA Lentiviral Transduction Particles
Vac14 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018052.3-2868s1c1
Sequence:CCGGCCACTCATCCTCTGGAATCAACTCGAGTTGATTCCAGAGGATGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018052.3-2892s1c1
Sequence:CCGGCTTTCTAATACCCTCTTGGAACTCGAGTTCCAAGAGGGTATTAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018052.3-310s1c1
Sequence:CCGGCTCAATGACAAGCTGTACGAACTCGAGTTCGTACAGCTTGTCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018052.3-1014s1c1
Sequence:CCGGCAGTGTGAAGTTTGCTGAGATCTCGAGATCTCAGCAAACTTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018052.3-396s1c1
Sequence:CCGGCGTGCAAATCAAGCATGTGATCTCGAGATCACATGCTTGATTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018052.3-2944s1c1
Sequence:CCGGGCTCTGGCCTTGTGTGTATATCTCGAGATATACACACAAGGCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018052.3-560s1c1
Sequence:CCGGGCTTCAATGATGCAGACAGCACTCGAGTGCTGTCTGCATCATTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018052.3-1592s21c1
Sequence:CCGGCCATCCTACTGCAGACGTTATCTCGAGATAACGTCTGCAGTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018052.3-793s21c1
Sequence:CCGGTTGTTGCGAGAGAGGATTTACCTCGAGGTAAATCCTCTCTCGCAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018052.3-923s21c1
Sequence:CCGGTCCAGATCCTGGGTGACAATGCTCGAGCATTGTCACCCAGGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018052.3-2637s21c1
Sequence:CCGGGTGGTCCCATGAAACACTAAGCTCGAGCTTAGTGTTTCATGGGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018052.3-396s21c1
Sequence:CCGGCGTGCAAATCAAGCATGTGATCTCGAGATCACATGCTTGATTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146216
VALIDATED
VAC14 MISSION shRNA Bacterial Glycerol Stock
Vac14 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146216.2-598s1c1
Sequence:CCGGGCCCTCTACAATATCGTCAAACTCGAGTTTGACGATATTGTAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146216.2-868s1c1
Sequence:CCGGCCAGACATTAACCTGCTGGATCTCGAGATCCAGCAGGTTAATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146216.2-600s1c1
Sequence:CCGGCCTCTACAATATCGTCAAAGTCTCGAGACTTTGACGATATTGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146216.2-1585s1c1
Sequence:CCGGCCCATCTTACTTCAGACATTACTCGAGTAATGTCTGAAGTAAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146216.2-296s21c1
Sequence:CCGGTAAGGGCCCTGAATGATAAACCTCGAGGTTTATCATTCAGGGCCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146216.2-1585s21c1
Sequence:CCGGCCCATCTTACTTCAGACATTACTCGAGTAATGTCTGAAGTAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146216.2-598s21c1
Sequence:CCGGGCCCTCTACAATATCGTCAAACTCGAGTTTGACGATATTGTAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146216.2-2637s21c1
Sequence:CCGGGAAGCACTCAGGGTCTCTAAGCTCGAGCTTAGAGACCCTGAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146216.2-2249s21c1
Sequence:CCGGACAAACTCGTGCAGCTAATTGCTCGAGCAATTAGCTGCACGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146216
VALIDATED
VAC14 MISSION shRNA shRNA Plasmid DNA
Vac14 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146216.2-598s1c1
Sequence:CCGGGCCCTCTACAATATCGTCAAACTCGAGTTTGACGATATTGTAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146216.2-868s1c1
Sequence:CCGGCCAGACATTAACCTGCTGGATCTCGAGATCCAGCAGGTTAATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146216.2-600s1c1
Sequence:CCGGCCTCTACAATATCGTCAAAGTCTCGAGACTTTGACGATATTGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146216.2-1585s1c1
Sequence:CCGGCCCATCTTACTTCAGACATTACTCGAGTAATGTCTGAAGTAAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146216.2-296s21c1
Sequence:CCGGTAAGGGCCCTGAATGATAAACCTCGAGGTTTATCATTCAGGGCCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146216.2-1585s21c1
Sequence:CCGGCCCATCTTACTTCAGACATTACTCGAGTAATGTCTGAAGTAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146216.2-598s21c1
Sequence:CCGGGCCCTCTACAATATCGTCAAACTCGAGTTTGACGATATTGTAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146216.2-2637s21c1
Sequence:CCGGGAAGCACTCAGGGTCTCTAAGCTCGAGCTTAGAGACCCTGAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146216.2-2249s21c1
Sequence:CCGGACAAACTCGTGCAGCTAATTGCTCGAGCAATTAGCTGCACGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146216
VALIDATED
VAC14 MISSION shRNA Lentiviral Transduction Particles
Vac14 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146216.2-598s1c1
Sequence:CCGGGCCCTCTACAATATCGTCAAACTCGAGTTTGACGATATTGTAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146216.2-868s1c1
Sequence:CCGGCCAGACATTAACCTGCTGGATCTCGAGATCCAGCAGGTTAATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146216.2-600s1c1
Sequence:CCGGCCTCTACAATATCGTCAAAGTCTCGAGACTTTGACGATATTGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146216.2-1585s1c1
Sequence:CCGGCCCATCTTACTTCAGACATTACTCGAGTAATGTCTGAAGTAAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146216.2-296s21c1
Sequence:CCGGTAAGGGCCCTGAATGATAAACCTCGAGGTTTATCATTCAGGGCCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146216.2-1585s21c1
Sequence:CCGGCCCATCTTACTTCAGACATTACTCGAGTAATGTCTGAAGTAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146216.2-598s21c1
Sequence:CCGGGCCCTCTACAATATCGTCAAACTCGAGTTTGACGATATTGTAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146216.2-2637s21c1
Sequence:CCGGGAAGCACTCAGGGTCTCTAAGCTCGAGCTTAGAGACCCTGAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146216.2-2249s21c1
Sequence:CCGGACAAACTCGTGCAGCTAATTGCTCGAGCAATTAGCTGCACGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks