EMAIL THIS PAGE TO A FRIEND

VAMP1

vesicle-associated membrane protein 1 (synaptobrevin 1)

Synonyms: SYB1 VAMP-1
Gene ID:
Human(6843) Summary: Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. VAMP1 is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Multiple alternative splice variants that encode proteins with alternative carboxy ends have been described, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
Mouse(22317) vesicle-associated membrane protein 1
Rat(25624) vesicle-associated membrane protein 1
Zebrafish(406707) vesicle-associated membrane protein 1
dog(486726) vesicle-associated membrane protein 1 (synaptobrevin 1)
chicken(418273) vesicle-associated membrane protein 1 (synaptobrevin 1)
cow(513621) vesicle-associated membrane protein 1 (synaptobrevin 1)
sheep(101113747) vesicle-associated membrane protein 1 (synaptobrevin 1)
naked mole-rat(101701965) vesicle-associated membrane protein 1 (synaptobrevin 1)
domestic guinea pig(100736172) vesicle-associated membrane protein 1 (synaptobrevin 1)
197 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009496 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009496 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009496 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014231 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU099431 MISSION® esiRNA esiRNA human VAMP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014231 Rosetta Predictions human pricing
NM_016830 Rosetta Predictions human pricing
NM_199245 Rosetta Predictions human pricing
NM_013090 Rosetta Predictions rat pricing
NM_001080557 Rosetta Predictions mouse pricing
NM_009496 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065745 predicted 217
2 SASI_Hs01_00065746 predicted 210
3 SASI_Hs02_00345259 predicted 203
4 SASI_Hs01_00065748 predicted 457
5 SASI_Hs01_00065749 predicted 457
6 SASI_Hs01_00065750 predicted 385
7 SASI_Hs02_00345260 predicted 848
8 SASI_Hs01_00065751 predicted 929
9 SASI_Hs01_00065753 predicted 462
10 SASI_Hs01_00065754 predicted 548
11 SASI_Hs01_00065747 predicted 232
12 SASI_Hs01_00065752 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349893 predicted 843
2 SASI_Hs02_00349894 predicted 848
3 SASI_Hs01_00022343 predicted 218
4 SASI_Hs01_00022344 predicted 765
5 SASI_Hs01_00022346 predicted 772
6 SASI_Hs01_00022347 predicted 847
7 SASI_Hs01_00022348 predicted 713
8 SASI_Hs01_00022350 predicted 216
9 SASI_Hs01_00022351 predicted 847
10 SASI_Hs02_00349895 predicted 206
11 SASI_Hs01_00022342 predicted 744
12 SASI_Hs01_00022345 predicted 855
13 SASI_Hs01_00022349 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076532 predicted 218
2 SASI_Hs01_00076533 predicted 211
3 SASI_Hs02_00372682 predicted 203
4 SASI_Hs01_00076535 predicted 460
5 SASI_Hs01_00076536 predicted 814
6 SASI_Hs01_00076537 predicted 458
7 SASI_Hs02_00372683 predicted 392
8 SASI_Hs02_00372684 predicted 687
9 SASI_Hs02_00372685 predicted 959
10 SASI_Hs01_00076540 predicted 869
11 SASI_Hs01_00076534 predicted 237
12 SASI_Hs01_00076538 predicted 809
13 SASI_Hs01_00076539 predicted 864
14 SASI_Hs01_00076541 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115704 predicted 629
2 SASI_Rn01_00115705 predicted 355
3 SASI_Rn01_00115706 predicted 447
4 SASI_Rn01_00115707 predicted 463
5 SASI_Rn02_00260857 predicted 606
6 SASI_Rn01_00115708 predicted 508
7 SASI_Rn01_00115709 predicted 367
8 SASI_Rn01_00115711 predicted 454
9 SASI_Rn01_00115712 predicted 302
10 SASI_Rn01_00115713 predicted 205
11 SASI_Rn01_00115710 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293513 predicted 462
2 SASI_Mm02_00293514 predicted 943
3 SASI_Mm02_00293515 predicted 786
4 SASI_Mm02_00293516 predicted 874
5 SASI_Mm02_00293517 predicted 459
6 SASI_Mm02_00293518 predicted 654
7 SASI_Mm02_00293519 predicted 795
8 SASI_Mm02_00293520 predicted 741
9 SASI_Mm02_00293521 predicted 362
10 SASI_Mm02_00293522 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079065 predicted 534
2 SASI_Mm01_00079066 predicted 617
3 SASI_Mm01_00079067 predicted 454
4 SASI_Mm02_00316248 predicted 450
5 SASI_Mm02_00316249 predicted 849
6 SASI_Mm02_00316250 predicted 759
7 SASI_Mm02_00316251 predicted 891
8 SASI_Mm02_00316252 predicted 623
9 SASI_Mm02_00316253 predicted 458
10 SASI_Mm01_00079070 predicted 279
11 SASI_Mm01_00079068 predicted 449
12 SASI_Mm01_00079069 predicted 616
13 SASI_Mm01_00079071 predicted 385
14 SASI_Mm01_00079072 predicted 370
15 SASI_Mm01_00079073 predicted 219
16 SASI_Mm01_00079074 predicted 697
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009496
VAMP1 MISSION shRNA Bacterial Glycerol Stock
vesicle-associated membrane protein 1 (synaptobrevin 1)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009496.3-363s21c1
Sequence:GTACCGGAGGCCGGAGCATCACAATTTGCTCGAGCAAATTGTGATGCTCCGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009496.3-466s21c1
Sequence:GTACCGGCATCGTGGTAGTGATTGTAATCTCGAGATTACAATCACTACCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009496.3-723s21c1
Sequence:GTACCGGCACCTCCTCCTTACCCATTTACTCGAGTAAATGGGTAAGGAGGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009496.3-385s21c1
Sequence:GTACCGGGAGCAGTGCTGCCAAGCTAAACTCGAGTTTAGCTTGGCAGCACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009496.3-993s21c1
Sequence:GTACCGGGGGAACTGTTGTCCTTATTTGCTCGAGCAAATAAGGACAACAGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009496.3-438s21c1
Sequence:GTACCGGTGATCATGCTGGGAGCTATCTCTCGAGAGATAGCTCCCAGCATGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009496.2-2201s1c1
Sequence:CCGGCGGGAATTATTTCCTGGGTTTCTCGAGAAACCCAGGAAATAATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009496.2-227s1c1
Sequence:CCGGCATGACCAGTAACAGGCGGTTCTCGAGAACCGCCTGTTACTGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009496.2-462s1c1
Sequence:CCGGGCCATCATCGTGGTAGTGATTCTCGAGAATCACTACCACGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009496.2-470s1c1
Sequence:CCGGCGTGGTAGTGATTGTAATCTACTCGAGTAGATTACAATCACTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009496.2-446s1c1
Sequence:CCGGGCTGGGAGCTATCTGTGCCATCTCGAGATGGCACAGATAGCTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009496
VAMP1 MISSION shRNA shRNA Plasmid DNA
vesicle-associated membrane protein 1 (synaptobrevin 1)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009496.3-363s21c1
Sequence:GTACCGGAGGCCGGAGCATCACAATTTGCTCGAGCAAATTGTGATGCTCCGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009496.3-466s21c1
Sequence:GTACCGGCATCGTGGTAGTGATTGTAATCTCGAGATTACAATCACTACCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009496.3-723s21c1
Sequence:GTACCGGCACCTCCTCCTTACCCATTTACTCGAGTAAATGGGTAAGGAGGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009496.3-385s21c1
Sequence:GTACCGGGAGCAGTGCTGCCAAGCTAAACTCGAGTTTAGCTTGGCAGCACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009496.3-993s21c1
Sequence:GTACCGGGGGAACTGTTGTCCTTATTTGCTCGAGCAAATAAGGACAACAGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009496.3-438s21c1
Sequence:GTACCGGTGATCATGCTGGGAGCTATCTCTCGAGAGATAGCTCCCAGCATGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009496.2-2201s1c1
Sequence:CCGGCGGGAATTATTTCCTGGGTTTCTCGAGAAACCCAGGAAATAATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009496.2-227s1c1
Sequence:CCGGCATGACCAGTAACAGGCGGTTCTCGAGAACCGCCTGTTACTGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009496.2-462s1c1
Sequence:CCGGGCCATCATCGTGGTAGTGATTCTCGAGAATCACTACCACGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009496.2-470s1c1
Sequence:CCGGCGTGGTAGTGATTGTAATCTACTCGAGTAGATTACAATCACTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009496.2-446s1c1
Sequence:CCGGGCTGGGAGCTATCTGTGCCATCTCGAGATGGCACAGATAGCTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009496
VAMP1 MISSION shRNA Lentiviral Transduction Particles
vesicle-associated membrane protein 1 (synaptobrevin 1)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009496.3-363s21c1
Sequence:GTACCGGAGGCCGGAGCATCACAATTTGCTCGAGCAAATTGTGATGCTCCGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009496.3-466s21c1
Sequence:GTACCGGCATCGTGGTAGTGATTGTAATCTCGAGATTACAATCACTACCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009496.3-723s21c1
Sequence:GTACCGGCACCTCCTCCTTACCCATTTACTCGAGTAAATGGGTAAGGAGGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009496.3-385s21c1
Sequence:GTACCGGGAGCAGTGCTGCCAAGCTAAACTCGAGTTTAGCTTGGCAGCACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009496.3-993s21c1
Sequence:GTACCGGGGGAACTGTTGTCCTTATTTGCTCGAGCAAATAAGGACAACAGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009496.3-438s21c1
Sequence:GTACCGGTGATCATGCTGGGAGCTATCTCTCGAGAGATAGCTCCCAGCATGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009496.2-2201s1c1
Sequence:CCGGCGGGAATTATTTCCTGGGTTTCTCGAGAAACCCAGGAAATAATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009496.2-227s1c1
Sequence:CCGGCATGACCAGTAACAGGCGGTTCTCGAGAACCGCCTGTTACTGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009496.2-462s1c1
Sequence:CCGGGCCATCATCGTGGTAGTGATTCTCGAGAATCACTACCACGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009496.2-470s1c1
Sequence:CCGGCGTGGTAGTGATTGTAATCTACTCGAGTAGATTACAATCACTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009496.2-446s1c1
Sequence:CCGGGCTGGGAGCTATCTGTGCCATCTCGAGATGGCACAGATAGCTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014231
VAMP1 MISSION shRNA Bacterial Glycerol Stock
vesicle-associated membrane protein 1 (synaptobrevin 1)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014231.3-461s1c1
Sequence:CCGGTGCCATCATCGTGGTAGTTATCTCGAGATAACTACCACGATGATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014231.3-362s1c1
Sequence:CCGGGCAGGCAGGAGCATCACAATTCTCGAGAATTGTGATGCTCCTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014231.3-247s21c1
Sequence:CCGGTACAGCAAACCCAGGCACAAGCTCGAGCTTGTGCCTGGGTTTGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014231.3-1427s21c1
Sequence:CCGGCCACTCCTTGCCCTCGTTAAACTCGAGTTTAACGAGGGCAAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014231.3-278s21c1
Sequence:CCGGGGTGGACATCATACGTGTGAACTCGAGTTCACACGTATGATGTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014231.3-427s21c1
Sequence:CCGGACTGCAAGATGATGATCATGCCTCGAGGCATGATCATCATCTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014231.3-219s21c1
Sequence:CCGGCCTCCTAACATGACCAGTAACCTCGAGGTTACTGGTCATGTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014231.3-396s1c1
Sequence:CCGGGCCAAGCTAAAGAGGAAGTATCTCGAGATACTTCCTCTTTAGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155272    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014231.3-2145s1c1
Sequence:CCGGGCTGGAAGAAAGCAGTCAGTACTCGAGTACTGACTGCTTTCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014231.3-397s1c1
Sequence:CCGGCCAAGCTAAAGAGGAAGTATTCTCGAGAATACTTCCTCTTTAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014231
VAMP1 MISSION shRNA shRNA Plasmid DNA
vesicle-associated membrane protein 1 (synaptobrevin 1)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014231.3-461s1c1
Sequence:CCGGTGCCATCATCGTGGTAGTTATCTCGAGATAACTACCACGATGATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014231.3-362s1c1
Sequence:CCGGGCAGGCAGGAGCATCACAATTCTCGAGAATTGTGATGCTCCTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014231.3-247s21c1
Sequence:CCGGTACAGCAAACCCAGGCACAAGCTCGAGCTTGTGCCTGGGTTTGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014231.3-1427s21c1
Sequence:CCGGCCACTCCTTGCCCTCGTTAAACTCGAGTTTAACGAGGGCAAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014231.3-278s21c1
Sequence:CCGGGGTGGACATCATACGTGTGAACTCGAGTTCACACGTATGATGTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014231.3-427s21c1
Sequence:CCGGACTGCAAGATGATGATCATGCCTCGAGGCATGATCATCATCTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014231.3-219s21c1
Sequence:CCGGCCTCCTAACATGACCAGTAACCTCGAGGTTACTGGTCATGTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014231.3-396s1c1
Sequence:CCGGGCCAAGCTAAAGAGGAAGTATCTCGAGATACTTCCTCTTTAGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155272    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014231.3-2145s1c1
Sequence:CCGGGCTGGAAGAAAGCAGTCAGTACTCGAGTACTGACTGCTTTCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014231.3-397s1c1
Sequence:CCGGCCAAGCTAAAGAGGAAGTATTCTCGAGAATACTTCCTCTTTAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014231
VAMP1 MISSION shRNA Lentiviral Transduction Particles
vesicle-associated membrane protein 1 (synaptobrevin 1)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014231.3-461s1c1
Sequence:CCGGTGCCATCATCGTGGTAGTTATCTCGAGATAACTACCACGATGATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014231.3-362s1c1
Sequence:CCGGGCAGGCAGGAGCATCACAATTCTCGAGAATTGTGATGCTCCTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014231.3-247s21c1
Sequence:CCGGTACAGCAAACCCAGGCACAAGCTCGAGCTTGTGCCTGGGTTTGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014231.3-1427s21c1
Sequence:CCGGCCACTCCTTGCCCTCGTTAAACTCGAGTTTAACGAGGGCAAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014231.3-278s21c1
Sequence:CCGGGGTGGACATCATACGTGTGAACTCGAGTTCACACGTATGATGTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014231.3-427s21c1
Sequence:CCGGACTGCAAGATGATGATCATGCCTCGAGGCATGATCATCATCTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014231.3-219s21c1
Sequence:CCGGCCTCCTAACATGACCAGTAACCTCGAGGTTACTGGTCATGTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014231.3-396s1c1
Sequence:CCGGGCCAAGCTAAAGAGGAAGTATCTCGAGATACTTCCTCTTTAGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155272    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014231.3-2145s1c1
Sequence:CCGGGCTGGAAGAAAGCAGTCAGTACTCGAGTACTGACTGCTTTCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014231.3-397s1c1
Sequence:CCGGCCAAGCTAAAGAGGAAGTATTCTCGAGAATACTTCCTCTTTAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks