EMAIL THIS PAGE TO A FRIEND

VAMP2

vesicle-associated membrane protein 2 (synaptobrevin 2)

Synonyms: SYB2 VAMP-2
UniProtKB ID: P63027, P19065, Q9BUC2
Gene ID:
Human(6844) Summary: The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. This gene is thought to participate in neurotransmitter release at a step between docking and fusion. The protein forms a stable complex with syntaxin, synaptosomal-associated protein, 25 kD, and synaptotagmin. It also forms a distinct complex with synaptophysin. It is a likely candidate gene for familial infantile myasthenia (FIMG) because of its map location and because it encodes a synaptic vesicle protein of the type that has been implicated in the pathogenesis of FIMG. [provided by RefSeq, Jul 2008]
Mouse(22318) vesicle-associated membrane protein 2
Rat(24803) vesicle-associated membrane protein 2
domestic guinea pig(100732271) vesicle-associated membrane protein 2 (synaptobrevin 2)
naked mole-rat(101711585) vesicle-associated membrane protein 2 (synaptobrevin 2)
cow(282116) vesicle-associated membrane protein 2 (synaptobrevin 2)
sheep(101122451) vesicle-associated membrane protein 2 (synaptobrevin 2)
Zebrafish(336281) vesicle-associated membrane protein 2
dog(479491) vesicle-associated membrane protein 2 (synaptobrevin 2)
domestic cat(101101516) vesicle-associated membrane protein 2 (synaptobrevin 2)
chicken(424827) vesicle-associated membrane protein 2 (synaptobrevin 2)
154 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0256 AQUA Peptide ADALQAGASQFETSAA[K] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009497 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009497 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009497 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014232 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128521 MISSION® esiRNA esiRNA human VAMP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014232 Rosetta Predictions human pricing
NM_012663 Rosetta Predictions rat pricing
NM_009497 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345261 predicted 421
2 SASI_Hs01_00013567 predicted 1042
3 SASI_Hs02_00345262 predicted 1325
4 SASI_Hs02_00345263 predicted 1088
5 SASI_Hs01_00013569 predicted 1129
6 SASI_Hs01_00013570 predicted 1595
7 SASI_Hs02_00345264 predicted 1790
8 SASI_Hs01_00013571 predicted 1893
9 SASI_Hs02_00345265 predicted 1504
10 SASI_Hs02_00345266 predicted 1031
11 SASI_Hs01_00013564 predicted 163
12 SASI_Hs01_00013565 predicted 426
13 SASI_Hs01_00013566 predicted 1060
14 SASI_Hs01_00013568 predicted 1510
15 SASI_Hs01_00013572 predicted 1842
16 SASI_Hs01_00013573 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012663 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052750 predicted 258
2 SASI_Rn01_00052751 predicted 247
3 SASI_Rn01_00052752 predicted 205
4 SASI_Rn01_00052753 predicted 244
5 SASI_Rn02_00259920 predicted 239
6 SASI_Rn01_00052754 predicted 253
7 SASI_Rn01_00052755 predicted 923
8 SASI_Rn01_00052756 predicted 146
9 SASI_Rn01_00052758 predicted 408
10 SASI_Rn02_00259921 predicted 913
11 SASI_Rn01_00052757 predicted 881
12 SASI_Rn01_00052759 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187119 predicted 276
2 SASI_Mm01_00187120 predicted 254
3 SASI_Mm01_00187118 predicted 227
4 SASI_Mm01_00187122 predicted 814
5 SASI_Mm01_00187123 predicted 738
6 SASI_Mm01_00187124 predicted 156
7 SASI_Mm01_00187125 predicted 802
8 SASI_Mm02_00316254 predicted 932
9 SASI_Mm01_00187127 predicted 423
10 SASI_Mm02_00316255 predicted 389
11 SASI_Mm01_00187121 predicted 234
12 SASI_Mm01_00187126 predicted 356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009497
VALIDATED
VAMP2 MISSION shRNA Bacterial Glycerol Stock
vesicle-associated membrane protein 2 (synaptobrevin 2)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009497.2-1494s1c1
Sequence:CCGGCCGACCACAATCTGGTTCTTTCTCGAGAAAGAACCAGATTGTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009497.2-350s1c1
Sequence:CCGGCAAGCGCAAATACTGGTGGAACTCGAGTTCCACCAGTATTTGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009497.2-173s1c1
Sequence:CCGGCCTTACTAGTAACAGGAGACTCTCGAGAGTCTCCTGTTACTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009497.2-374s1c1
Sequence:CCGGCCTCAAGATGATGATCATCTTCTCGAGAAGATGATCATCATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009497.2-428s1c1
Sequence:CCGGCATCGTTTACTTCAGCACTTACTCGAGTAAGTGCTGAAGTAAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009497.3-344s21c1
Sequence:CCGGCAAGCTCAAGCGCAAATACTGCTCGAGCAGTATTTGCGCTTGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009497.3-404s21c1
Sequence:CCGGCTGCGCCATCATCCTCATCATCTCGAGATGATGAGGATGATGGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009497.3-796s21c1
Sequence:CCGGCTTGGATTTAACCGATCTTTCCTCGAGGAAAGATCGGTTAAATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009497.3-158s21c1
Sequence:CCGGTGCACCTCCTCCAAACCTTACCTCGAGGTAAGGTTTGGAGGAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009497.3-374s21c1
Sequence:CCGGCCTCAAGATGATGATCATCTTCTCGAGAAGATGATCATCATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009497.3-173s21c1
Sequence:CCGGCCTTACTAGTAACAGGAGACTCTCGAGAGTCTCCTGTTACTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009497
VALIDATED
VAMP2 MISSION shRNA shRNA Plasmid DNA
vesicle-associated membrane protein 2 (synaptobrevin 2)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009497.2-1494s1c1
Sequence:CCGGCCGACCACAATCTGGTTCTTTCTCGAGAAAGAACCAGATTGTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009497.2-350s1c1
Sequence:CCGGCAAGCGCAAATACTGGTGGAACTCGAGTTCCACCAGTATTTGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009497.2-173s1c1
Sequence:CCGGCCTTACTAGTAACAGGAGACTCTCGAGAGTCTCCTGTTACTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009497.2-374s1c1
Sequence:CCGGCCTCAAGATGATGATCATCTTCTCGAGAAGATGATCATCATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009497.2-428s1c1
Sequence:CCGGCATCGTTTACTTCAGCACTTACTCGAGTAAGTGCTGAAGTAAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009497.3-344s21c1
Sequence:CCGGCAAGCTCAAGCGCAAATACTGCTCGAGCAGTATTTGCGCTTGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009497.3-404s21c1
Sequence:CCGGCTGCGCCATCATCCTCATCATCTCGAGATGATGAGGATGATGGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009497.3-796s21c1
Sequence:CCGGCTTGGATTTAACCGATCTTTCCTCGAGGAAAGATCGGTTAAATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009497.3-158s21c1
Sequence:CCGGTGCACCTCCTCCAAACCTTACCTCGAGGTAAGGTTTGGAGGAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009497.3-374s21c1
Sequence:CCGGCCTCAAGATGATGATCATCTTCTCGAGAAGATGATCATCATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009497.3-173s21c1
Sequence:CCGGCCTTACTAGTAACAGGAGACTCTCGAGAGTCTCCTGTTACTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009497
VALIDATED
VAMP2 MISSION shRNA Lentiviral Transduction Particles
vesicle-associated membrane protein 2 (synaptobrevin 2)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009497.2-1494s1c1
Sequence:CCGGCCGACCACAATCTGGTTCTTTCTCGAGAAAGAACCAGATTGTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009497.2-350s1c1
Sequence:CCGGCAAGCGCAAATACTGGTGGAACTCGAGTTCCACCAGTATTTGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009497.2-173s1c1
Sequence:CCGGCCTTACTAGTAACAGGAGACTCTCGAGAGTCTCCTGTTACTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009497.2-374s1c1
Sequence:CCGGCCTCAAGATGATGATCATCTTCTCGAGAAGATGATCATCATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009497.2-428s1c1
Sequence:CCGGCATCGTTTACTTCAGCACTTACTCGAGTAAGTGCTGAAGTAAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009497.3-344s21c1
Sequence:CCGGCAAGCTCAAGCGCAAATACTGCTCGAGCAGTATTTGCGCTTGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009497.3-404s21c1
Sequence:CCGGCTGCGCCATCATCCTCATCATCTCGAGATGATGAGGATGATGGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009497.3-796s21c1
Sequence:CCGGCTTGGATTTAACCGATCTTTCCTCGAGGAAAGATCGGTTAAATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009497.3-158s21c1
Sequence:CCGGTGCACCTCCTCCAAACCTTACCTCGAGGTAAGGTTTGGAGGAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009497.3-374s21c1
Sequence:CCGGCCTCAAGATGATGATCATCTTCTCGAGAAGATGATCATCATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009497.3-173s21c1
Sequence:CCGGCCTTACTAGTAACAGGAGACTCTCGAGAGTCTCCTGTTACTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014232
VALIDATED
VAMP2 MISSION shRNA Bacterial Glycerol Stock
vesicle-associated membrane protein 2 (synaptobrevin 2)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014232.1-804s1c1
Sequence:CCGGCCTCAGATTTAGCTGATCCTTCTCGAGAAGGATCAGCTAAATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147899    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_014232.1-1050s1c1
Sequence:CCGGGCGTATCATTACATACTGCTACTCGAGTAGCAGTATGTAATGATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_014232.1-406s1c1
Sequence:CCGGCATCATCCTCATCATCATCATCTCGAGATGATGATGATGAGGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014232.1-1067s1c1
Sequence:CCGGGCTATCCCTTTCCATTTCTTTCTCGAGAAAGAAATGGAAAGGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014232.2-1836s21c1
Sequence:CCGGCTGATTGAGGAAGGGTCTATTCTCGAGAATAGACCCTTCCTCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014232.2-231s21c1
Sequence:CCGGCATGAGGGTGAACGTGGACAACTCGAGTTGTCCACGTTCACCCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014232.2-383s21c1
Sequence:CCGGTGATCATCTTGGGAGTGATTTCTCGAGAAATCACTCCCAAGATGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014232.2-162s21c1
Sequence:CCGGCCCTCCAAACCTCACCAGTAACTCGAGTTACTGGTGAGGTTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014232.2-340s21c1
Sequence:CCGGGCCAAGCTCAAGCGCAAATACCTCGAGGTATTTGCGCTTGAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014232
VALIDATED
VAMP2 MISSION shRNA shRNA Plasmid DNA
vesicle-associated membrane protein 2 (synaptobrevin 2)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014232.1-804s1c1
Sequence:CCGGCCTCAGATTTAGCTGATCCTTCTCGAGAAGGATCAGCTAAATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147899    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_014232.1-1050s1c1
Sequence:CCGGGCGTATCATTACATACTGCTACTCGAGTAGCAGTATGTAATGATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_014232.1-406s1c1
Sequence:CCGGCATCATCCTCATCATCATCATCTCGAGATGATGATGATGAGGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014232.1-1067s1c1
Sequence:CCGGGCTATCCCTTTCCATTTCTTTCTCGAGAAAGAAATGGAAAGGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014232.2-1836s21c1
Sequence:CCGGCTGATTGAGGAAGGGTCTATTCTCGAGAATAGACCCTTCCTCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014232.2-231s21c1
Sequence:CCGGCATGAGGGTGAACGTGGACAACTCGAGTTGTCCACGTTCACCCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014232.2-383s21c1
Sequence:CCGGTGATCATCTTGGGAGTGATTTCTCGAGAAATCACTCCCAAGATGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014232.2-162s21c1
Sequence:CCGGCCCTCCAAACCTCACCAGTAACTCGAGTTACTGGTGAGGTTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014232.2-340s21c1
Sequence:CCGGGCCAAGCTCAAGCGCAAATACCTCGAGGTATTTGCGCTTGAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014232
VALIDATED
VAMP2 MISSION shRNA Lentiviral Transduction Particles
vesicle-associated membrane protein 2 (synaptobrevin 2)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014232.1-804s1c1
Sequence:CCGGCCTCAGATTTAGCTGATCCTTCTCGAGAAGGATCAGCTAAATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147899    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_014232.1-1050s1c1
Sequence:CCGGGCGTATCATTACATACTGCTACTCGAGTAGCAGTATGTAATGATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_014232.1-406s1c1
Sequence:CCGGCATCATCCTCATCATCATCATCTCGAGATGATGATGATGAGGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014232.1-1067s1c1
Sequence:CCGGGCTATCCCTTTCCATTTCTTTCTCGAGAAAGAAATGGAAAGGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014232.2-1836s21c1
Sequence:CCGGCTGATTGAGGAAGGGTCTATTCTCGAGAATAGACCCTTCCTCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014232.2-231s21c1
Sequence:CCGGCATGAGGGTGAACGTGGACAACTCGAGTTGTCCACGTTCACCCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014232.2-383s21c1
Sequence:CCGGTGATCATCTTGGGAGTGATTTCTCGAGAAATCACTCCCAAGATGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014232.2-162s21c1
Sequence:CCGGCCCTCCAAACCTCACCAGTAACTCGAGTTACTGGTGAGGTTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014232.2-340s21c1
Sequence:CCGGGCCAAGCTCAAGCGCAAATACCTCGAGGTATTTGCGCTTGAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks