EMAIL THIS PAGE TO A FRIEND

VAMP3

vesicle-associated membrane protein 3

Synonyms: CEB
UniProtKB ID: Q15836
Gene ID:
Human(9341) Summary: Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. This gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Because of its high homology to other known VAMPs, its broad tissue distribution, and its subcellular localization, the protein encoded by this gene was shown to be the human equivalent of the rodent cellubrevin. In platelets the protein resides on a compartment that is not mobilized to the plasma membrane on calcium or thrombin stimulation. [provided by RefSeq, Jul 2008]
Mouse(22319) vesicle-associated membrane protein 3
Rat(29528) vesicle-associated membrane protein 3
Zebrafish(415163) vesicle-associated membrane protein 3 (cellubrevin)
domestic cat(101095593) vesicle-associated membrane protein 3
chicken(419368) vesicle-associated membrane protein 3 (cellubrevin)
cow(505379) vesicle-associated membrane protein 3 (cellubrevin)
sheep(101115638) vesicle-associated membrane protein 3
naked mole-rat(101725237) vesicle-associated membrane protein 3
domestic guinea pig(100731471) vesicle-associated membrane protein 3
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302648 ANTI-VAMP3 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0256 AQUA Peptide ADALQAGASQFETSAA[K] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009498 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009498 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009498 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004781 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091591 MISSION® esiRNA esiRNA human VAMP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004781 Rosetta Predictions human pricing
NM_057097 Rosetta Predictions rat pricing
NM_009498 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159451 predicted 196
2 SASI_Hs01_00159444 predicted 695
3 SASI_Hs01_00159445 predicted 356
4 SASI_Hs01_00159446 predicted 461
5 SASI_Hs01_00159447 predicted 640
6 SASI_Hs01_00159448 predicted 639
7 SASI_Hs01_00159449 predicted 721
8 SASI_Hs01_00159450 predicted 619
9 SASI_Hs01_00159452 predicted 717
10 SASI_Hs02_00338292 predicted 706
11 SASI_Hs01_00159443 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119036 predicted 721
2 SASI_Rn01_00119037 predicted 751
3 SASI_Rn01_00119038 predicted 733
4 SASI_Rn01_00119040 predicted 153
5 SASI_Rn01_00119042 predicted 570
6 SASI_Rn01_00119043 predicted 333
7 SASI_Rn01_00119045 predicted 640
8 SASI_Rn02_00267019 predicted 314
9 SASI_Rn02_00267020 predicted 158
10 SASI_Rn02_00267021 predicted 107
11 SASI_Rn01_00119039 predicted 804
12 SASI_Rn01_00119041 predicted 704
13 SASI_Rn01_00119044 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316256 predicted 819
2 SASI_Mm02_00316257 predicted 767
3 SASI_Mm02_00316258 predicted 831
4 SASI_Mm02_00316259 predicted 862
5 SASI_Mm02_00316260 predicted 736
6 SASI_Mm02_00316261 predicted 430
7 SASI_Mm02_00316262 predicted 182
8 SASI_Mm02_00316263 predicted 436
9 SASI_Mm02_00316264 predicted 390
10 SASI_Mm02_00316265 predicted 599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009498
VALIDATED
VAMP3 MISSION shRNA Bacterial Glycerol Stock
vesicle-associated membrane protein 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009498.4-255s21c1
Sequence:CCGGAGGTGCCTCGCAGTTTGAAACCTCGAGGTTTCAAACTGCGAGGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009498.4-401s21c1
Sequence:CCGGATGAAACTGAAGCCCGATATTCTCGAGAATATCGGGCTTCAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009498.4-338s21c1
Sequence:CCGGTCAGTGTCCTGGTGATCATTGCTCGAGCAATGATCACCAGGACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009498.4-369s21c1
Sequence:CCGGCATCGTGTGGTGTGTCTCTTACTCGAGTAAGAGACACACCACACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009498.4-284s21c1
Sequence:CCGGCCAAGTTGAAGAGAAAGTATTCTCGAGAATACTTTCTCTTCAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009498.4-106s21c1
Sequence:CCGGAGTGCTGCCACTGGCAGTAATCTCGAGATTACTGCCAGTGGCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009498.3-1638s1c1
Sequence:CCGGGCCACTAGAATGTCCTGAAATCTCGAGATTTCAGGACATTCTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009498.3-285s1c1
Sequence:CCGGCCAAGTTGAAGAGAAAGTATTCTCGAGAATACTTTCTCTTCAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009498.3-370s1c1
Sequence:CCGGCATCGTGTGGTGTGTCTCTTACTCGAGTAAGAGACACACCACACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009498.3-295s1c1
Sequence:CCGGGAGAAAGTATTGGTGGAAGAACTCGAGTTCTTCCACCAATACTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009498.3-182s1c1
Sequence:CCGGGTCAATGTGGATAAGGTGTTACTCGAGTAACACCTTATCCACATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009498
VALIDATED
VAMP3 MISSION shRNA shRNA Plasmid DNA
vesicle-associated membrane protein 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009498.4-255s21c1
Sequence:CCGGAGGTGCCTCGCAGTTTGAAACCTCGAGGTTTCAAACTGCGAGGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009498.4-401s21c1
Sequence:CCGGATGAAACTGAAGCCCGATATTCTCGAGAATATCGGGCTTCAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009498.4-338s21c1
Sequence:CCGGTCAGTGTCCTGGTGATCATTGCTCGAGCAATGATCACCAGGACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009498.4-369s21c1
Sequence:CCGGCATCGTGTGGTGTGTCTCTTACTCGAGTAAGAGACACACCACACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009498.4-284s21c1
Sequence:CCGGCCAAGTTGAAGAGAAAGTATTCTCGAGAATACTTTCTCTTCAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009498.4-106s21c1
Sequence:CCGGAGTGCTGCCACTGGCAGTAATCTCGAGATTACTGCCAGTGGCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009498.3-1638s1c1
Sequence:CCGGGCCACTAGAATGTCCTGAAATCTCGAGATTTCAGGACATTCTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009498.3-285s1c1
Sequence:CCGGCCAAGTTGAAGAGAAAGTATTCTCGAGAATACTTTCTCTTCAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009498.3-370s1c1
Sequence:CCGGCATCGTGTGGTGTGTCTCTTACTCGAGTAAGAGACACACCACACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009498.3-295s1c1
Sequence:CCGGGAGAAAGTATTGGTGGAAGAACTCGAGTTCTTCCACCAATACTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009498.3-182s1c1
Sequence:CCGGGTCAATGTGGATAAGGTGTTACTCGAGTAACACCTTATCCACATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009498
VALIDATED
VAMP3 MISSION shRNA Lentiviral Transduction Particles
vesicle-associated membrane protein 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009498.4-255s21c1
Sequence:CCGGAGGTGCCTCGCAGTTTGAAACCTCGAGGTTTCAAACTGCGAGGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009498.4-401s21c1
Sequence:CCGGATGAAACTGAAGCCCGATATTCTCGAGAATATCGGGCTTCAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009498.4-338s21c1
Sequence:CCGGTCAGTGTCCTGGTGATCATTGCTCGAGCAATGATCACCAGGACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009498.4-369s21c1
Sequence:CCGGCATCGTGTGGTGTGTCTCTTACTCGAGTAAGAGACACACCACACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009498.4-284s21c1
Sequence:CCGGCCAAGTTGAAGAGAAAGTATTCTCGAGAATACTTTCTCTTCAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009498.4-106s21c1
Sequence:CCGGAGTGCTGCCACTGGCAGTAATCTCGAGATTACTGCCAGTGGCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009498.3-1638s1c1
Sequence:CCGGGCCACTAGAATGTCCTGAAATCTCGAGATTTCAGGACATTCTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009498.3-285s1c1
Sequence:CCGGCCAAGTTGAAGAGAAAGTATTCTCGAGAATACTTTCTCTTCAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009498.3-370s1c1
Sequence:CCGGCATCGTGTGGTGTGTCTCTTACTCGAGTAAGAGACACACCACACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009498.3-295s1c1
Sequence:CCGGGAGAAAGTATTGGTGGAAGAACTCGAGTTCTTCCACCAATACTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009498.3-182s1c1
Sequence:CCGGGTCAATGTGGATAAGGTGTTACTCGAGTAACACCTTATCCACATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004781
VALIDATED
VAMP3 MISSION shRNA Bacterial Glycerol Stock
vesicle-associated membrane protein 3
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-470s21c1
Sequence:CCGGGACTTAGAACCTGCTATATTACTCGAGTAATATAGCAGGTTCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-305s21c1
Sequence:CCGGGCAGCCAAGTTGAAGAGGAAACTCGAGTTTCCTCTTCAACTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-279s21c1
Sequence:CCGGCAGGCGCTTCTCAATTTGAAACTCGAGTTTCAAATTGAGAAGCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004781.3-189s21c1
Sequence:CCGGTGGTGGACATAATGCGAGTTACTCGAGTAACTCGCATTATGTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004781.3-914s21c1
Sequence:GTACCGGACTACTGACTCTCGCTGTATTCTCGAGAATACAGCGAGAGTCAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004781.3-345s21c1
Sequence:GTACCGGAGATGTGGGCAATCGGGATTACTCGAGTAATCCCGATTGCCCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-663s21c1
Sequence:GTACCGGTAAGTTCCAGAGTGCTATAATCTCGAGATTATAGCACTCTGGAACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-234s21c1
Sequence:GTACCGGACCAGAAGCTCTCTGAGTTAGCTCGAGCTAACTCAGAGAGCTTCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-212s21c1
Sequence:GTACCGGGTGGACAAGGTTCTGGAAAGACTCGAGTCTTTCCAGAACCTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-391s21c1
Sequence:GTACCGGCATCATCGTGTGGGTTGTCTCCTCGAGGAGACAACCCACACGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004781.3-358s1c1
Sequence:CCGGCGGGATTACTGTTCTGGTTATCTCGAGATAACCAGAACAGTAATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004781.3-279s1c1
Sequence:CCGGCAGGCGCTTCTCAATTTGAAACTCGAGTTTCAAATTGAGAAGCGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004781.3-203s1c1
Sequence:CCGGCGAGTTAACGTGGACAAGGTTCTCGAGAACCTTGTCCACGTTAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004781.3-189s1c1
Sequence:CCGGTGGTGGACATAATGCGAGTTACTCGAGTAACTCGCATTATGTCCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004781.3-305s1c1
Sequence:CCGGGCAGCCAAGTTGAAGAGGAAACTCGAGTTTCCTCTTCAACTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004781
VALIDATED
VAMP3 MISSION shRNA shRNA Plasmid DNA
vesicle-associated membrane protein 3
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-470s21c1
Sequence:CCGGGACTTAGAACCTGCTATATTACTCGAGTAATATAGCAGGTTCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-305s21c1
Sequence:CCGGGCAGCCAAGTTGAAGAGGAAACTCGAGTTTCCTCTTCAACTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-279s21c1
Sequence:CCGGCAGGCGCTTCTCAATTTGAAACTCGAGTTTCAAATTGAGAAGCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004781.3-189s21c1
Sequence:CCGGTGGTGGACATAATGCGAGTTACTCGAGTAACTCGCATTATGTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004781.3-914s21c1
Sequence:GTACCGGACTACTGACTCTCGCTGTATTCTCGAGAATACAGCGAGAGTCAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004781.3-345s21c1
Sequence:GTACCGGAGATGTGGGCAATCGGGATTACTCGAGTAATCCCGATTGCCCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-663s21c1
Sequence:GTACCGGTAAGTTCCAGAGTGCTATAATCTCGAGATTATAGCACTCTGGAACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-234s21c1
Sequence:GTACCGGACCAGAAGCTCTCTGAGTTAGCTCGAGCTAACTCAGAGAGCTTCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-212s21c1
Sequence:GTACCGGGTGGACAAGGTTCTGGAAAGACTCGAGTCTTTCCAGAACCTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-391s21c1
Sequence:GTACCGGCATCATCGTGTGGGTTGTCTCCTCGAGGAGACAACCCACACGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004781.3-358s1c1
Sequence:CCGGCGGGATTACTGTTCTGGTTATCTCGAGATAACCAGAACAGTAATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004781.3-279s1c1
Sequence:CCGGCAGGCGCTTCTCAATTTGAAACTCGAGTTTCAAATTGAGAAGCGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004781.3-203s1c1
Sequence:CCGGCGAGTTAACGTGGACAAGGTTCTCGAGAACCTTGTCCACGTTAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004781.3-189s1c1
Sequence:CCGGTGGTGGACATAATGCGAGTTACTCGAGTAACTCGCATTATGTCCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004781.3-305s1c1
Sequence:CCGGGCAGCCAAGTTGAAGAGGAAACTCGAGTTTCCTCTTCAACTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004781
VALIDATED
VAMP3 MISSION shRNA Lentiviral Transduction Particles
vesicle-associated membrane protein 3
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-470s21c1
Sequence:CCGGGACTTAGAACCTGCTATATTACTCGAGTAATATAGCAGGTTCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-305s21c1
Sequence:CCGGGCAGCCAAGTTGAAGAGGAAACTCGAGTTTCCTCTTCAACTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-279s21c1
Sequence:CCGGCAGGCGCTTCTCAATTTGAAACTCGAGTTTCAAATTGAGAAGCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004781.3-189s21c1
Sequence:CCGGTGGTGGACATAATGCGAGTTACTCGAGTAACTCGCATTATGTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004781.3-914s21c1
Sequence:GTACCGGACTACTGACTCTCGCTGTATTCTCGAGAATACAGCGAGAGTCAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004781.3-345s21c1
Sequence:GTACCGGAGATGTGGGCAATCGGGATTACTCGAGTAATCCCGATTGCCCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-663s21c1
Sequence:GTACCGGTAAGTTCCAGAGTGCTATAATCTCGAGATTATAGCACTCTGGAACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-234s21c1
Sequence:GTACCGGACCAGAAGCTCTCTGAGTTAGCTCGAGCTAACTCAGAGAGCTTCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-212s21c1
Sequence:GTACCGGGTGGACAAGGTTCTGGAAAGACTCGAGTCTTTCCAGAACCTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004781.3-391s21c1
Sequence:GTACCGGCATCATCGTGTGGGTTGTCTCCTCGAGGAGACAACCCACACGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004781.3-358s1c1
Sequence:CCGGCGGGATTACTGTTCTGGTTATCTCGAGATAACCAGAACAGTAATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004781.3-279s1c1
Sequence:CCGGCAGGCGCTTCTCAATTTGAAACTCGAGTTTCAAATTGAGAAGCGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004781.3-203s1c1
Sequence:CCGGCGAGTTAACGTGGACAAGGTTCTCGAGAACCTTGTCCACGTTAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004781.3-189s1c1
Sequence:CCGGTGGTGGACATAATGCGAGTTACTCGAGTAACTCGCATTATGTCCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004781.3-305s1c1
Sequence:CCGGGCAGCCAAGTTGAAGAGGAAACTCGAGTTTCCTCTTCAACTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks