EMAIL THIS PAGE TO A FRIEND

VAMP4

vesicle-associated membrane protein 4

Synonyms: VAMP-4 VAMP24
UniProtKB ID: O75379, A2IDD8, Q96IY9, Q96J20, Q9UEL7
Gene ID:
Human(8674) Summary: Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. This protein may play a role in trans-Golgi network-to-endosome transport. [provided by RefSeq, Jul 2008]
Mouse(53330) vesicle-associated membrane protein 4
Rat(364033) vesicle-associated membrane protein 4
domestic guinea pig(100734370) vesicle-associated membrane protein 4
naked mole-rat(101704828) vesicle-associated membrane protein 4
cow(616923) vesicle-associated membrane protein 4
sheep(101106092) vesicle-associated membrane protein 4
Zebrafish(393708) vesicle-associated membrane protein 4
domestic cat(101087894) vesicle-associated membrane protein 4
dog(480074) vesicle-associated membrane protein 4
chicken(770513) vesicle-associated membrane protein 4
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003762 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016796 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016796 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016796 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003762 Rosetta Predictions human pricing
NM_001108856 Rosetta Predictions rat pricing
NM_016796 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220136 predicted 661
2 SASI_Hs01_00220137 predicted 461
3 SASI_Hs02_00336248 predicted 639
4 SASI_Hs02_00336249 predicted 620
5 SASI_Hs01_00220139 predicted 593
6 SASI_Hs01_00220140 predicted 481
7 SASI_Hs01_00220142 predicted 213
8 SASI_Hs01_00220143 predicted 705
9 SASI_Hs01_00220144 predicted 450
10 SASI_Hs02_00336250 predicted 237
11 SASI_Hs01_00220138 predicted 343
12 SASI_Hs01_00220141 predicted 623
13 SASI_Hs01_00220145 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242755 predicted 360
2 SASI_Rn02_00242756 predicted 389
3 SASI_Rn02_00242757 predicted 509
4 SASI_Rn02_00242758 predicted 311
5 SASI_Rn02_00242759 predicted 831
6 SASI_Rn02_00242760 predicted 507
7 SASI_Rn02_00242761 predicted 513
8 SASI_Rn02_00242762 predicted 246
9 SASI_Rn02_00242763 predicted 554
10 SASI_Rn02_00242764 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172967 predicted 358
2 SASI_Mm01_00172968 predicted 503
3 SASI_Mm02_00323576 predicted 849
4 SASI_Mm01_00172970 predicted 302
5 SASI_Mm01_00172971 predicted 551
6 SASI_Mm01_00172973 predicted 546
7 SASI_Mm01_00172974 predicted 371
8 SASI_Mm02_00323577 predicted 269
9 SASI_Mm02_00323578 predicted 385
10 SASI_Mm02_00323579 predicted 402
11 SASI_Mm01_00172966 predicted 823
12 SASI_Mm01_00172969 predicted 502
13 SASI_Mm01_00172972 predicted 514
14 SASI_Mm01_00172975 predicted 960
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003762
VAMP4 MISSION shRNA Bacterial Glycerol Stock
vesicle-associated membrane protein 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003762.2-342s1c1
Sequence:CCGGGACCAAGATTTGGACCTAGAACTCGAGTTCTAGGTCCAAATCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003762.2-333s1c1
Sequence:CCGGGACCATCTGGACCAAGATTTGCTCGAGCAAATCTTGGTCCAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003762.2-339s1c1
Sequence:CCGGCTGGACCAAGATTTGGACCTACTCGAGTAGGTCCAAATCTTGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003762.2-848s1c1
Sequence:CCGGGCAAAGAGAACTAGCCTCTATCTCGAGATAGAGGCTAGTTCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003762.2-376s1c1
Sequence:CCGGGCATGTTCAGAATCAAGTGGACTCGAGTCCACTTGATTCTGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003762.3-620s21c1
Sequence:GTACCGGGTCATGAAATACCGTACTTGACTCGAGTCAAGTACGGTATTTCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003762.3-332s21c1
Sequence:GTACCGGGGACCATCTGGACCAAGATTTCTCGAGAAATCTTGGTCCAGATGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003762.3-520s21c1
Sequence:GTACCGGCAAACAACTTCGAAGGCAAATCTCGAGATTTGCCTTCGAAGTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003762.3-476s21c1
Sequence:GTACCGGTCAGAAAGCTTATCGGATAATCTCGAGATTATCCGATAAGCTTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003762
VAMP4 MISSION shRNA shRNA Plasmid DNA
vesicle-associated membrane protein 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003762.2-342s1c1
Sequence:CCGGGACCAAGATTTGGACCTAGAACTCGAGTTCTAGGTCCAAATCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003762.2-333s1c1
Sequence:CCGGGACCATCTGGACCAAGATTTGCTCGAGCAAATCTTGGTCCAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003762.2-339s1c1
Sequence:CCGGCTGGACCAAGATTTGGACCTACTCGAGTAGGTCCAAATCTTGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003762.2-848s1c1
Sequence:CCGGGCAAAGAGAACTAGCCTCTATCTCGAGATAGAGGCTAGTTCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003762.2-376s1c1
Sequence:CCGGGCATGTTCAGAATCAAGTGGACTCGAGTCCACTTGATTCTGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003762.3-620s21c1
Sequence:GTACCGGGTCATGAAATACCGTACTTGACTCGAGTCAAGTACGGTATTTCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003762.3-332s21c1
Sequence:GTACCGGGGACCATCTGGACCAAGATTTCTCGAGAAATCTTGGTCCAGATGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003762.3-520s21c1
Sequence:GTACCGGCAAACAACTTCGAAGGCAAATCTCGAGATTTGCCTTCGAAGTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003762.3-476s21c1
Sequence:GTACCGGTCAGAAAGCTTATCGGATAATCTCGAGATTATCCGATAAGCTTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003762
VAMP4 MISSION shRNA Lentiviral Transduction Particles
vesicle-associated membrane protein 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003762.2-342s1c1
Sequence:CCGGGACCAAGATTTGGACCTAGAACTCGAGTTCTAGGTCCAAATCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003762.2-333s1c1
Sequence:CCGGGACCATCTGGACCAAGATTTGCTCGAGCAAATCTTGGTCCAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003762.2-339s1c1
Sequence:CCGGCTGGACCAAGATTTGGACCTACTCGAGTAGGTCCAAATCTTGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003762.2-848s1c1
Sequence:CCGGGCAAAGAGAACTAGCCTCTATCTCGAGATAGAGGCTAGTTCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003762.2-376s1c1
Sequence:CCGGGCATGTTCAGAATCAAGTGGACTCGAGTCCACTTGATTCTGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003762.3-620s21c1
Sequence:GTACCGGGTCATGAAATACCGTACTTGACTCGAGTCAAGTACGGTATTTCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003762.3-332s21c1
Sequence:GTACCGGGGACCATCTGGACCAAGATTTCTCGAGAAATCTTGGTCCAGATGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003762.3-520s21c1
Sequence:GTACCGGCAAACAACTTCGAAGGCAAATCTCGAGATTTGCCTTCGAAGTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003762.3-476s21c1
Sequence:GTACCGGTCAGAAAGCTTATCGGATAATCTCGAGATTATCCGATAAGCTTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016796
VALIDATED
VAMP4 MISSION shRNA Bacterial Glycerol Stock
vesicle-associated membrane protein 4
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016796.2-1397s1c1
Sequence:CCGGGCCATCTTAGTCCATACAAATCTCGAGATTTGTATGGACTAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016796.2-360s1c1
Sequence:CCGGCAGGACAAATCAGAAAGCTTACTCGAGTAAGCTTTCTGATTTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016796.2-391s1c1
Sequence:CCGGCCACCGCTTTCAGCAACAGATCTCGAGATCTGTTGCTGAAAGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016796.2-237s1c1
Sequence:CCGGCCAAGATTTGGACCTAGAAATCTCGAGATTTCTAGGTCCAAATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016796.2-347s1c1
Sequence:CCGGGCTGGATGAACTACAGGACAACTCGAGTTGTCCTGTAGTTCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016796.3-345s21c1
Sequence:CCGGGCTGGATGAACTACAGGACAACTCGAGTTGTCCTGTAGTTCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016796.3-367s21c1
Sequence:CCGGTCAGAAAGCTTATCGGATAATCTCGAGATTATCCGATAAGCTTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016796.3-223s21c1
Sequence:CCGGGGACCATCTGGACCAAGATTTCTCGAGAAATCTTGGTCCAGATGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016796.3-714s21c1
Sequence:CCGGGGGTTCCTCCTCCATCATAACCTCGAGGTTATGATGGAGGAGGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016796.3-805s21c1
Sequence:CCGGAGTTTATAAGCTGGGAAATTTCTCGAGAAATTTCCCAGCTTATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016796.3-304s21c1
Sequence:GTACCGGATGCAAGAGAATATTACAAAGCTCGAGCTTTGTAATATTCTCTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016796.3-609s21c1
Sequence:GTACCGGTTAGTTGATGCCCAGTGAAATCTCGAGATTTCACTGGGCATCAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016796.3-411s21c1
Sequence:GTACCGGCAAACAGCTTCGAAGGCAAATCTCGAGATTTGCCTTCGAAGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016796
VALIDATED
VAMP4 MISSION shRNA shRNA Plasmid DNA
vesicle-associated membrane protein 4
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016796.2-1397s1c1
Sequence:CCGGGCCATCTTAGTCCATACAAATCTCGAGATTTGTATGGACTAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016796.2-360s1c1
Sequence:CCGGCAGGACAAATCAGAAAGCTTACTCGAGTAAGCTTTCTGATTTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016796.2-391s1c1
Sequence:CCGGCCACCGCTTTCAGCAACAGATCTCGAGATCTGTTGCTGAAAGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016796.2-237s1c1
Sequence:CCGGCCAAGATTTGGACCTAGAAATCTCGAGATTTCTAGGTCCAAATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016796.2-347s1c1
Sequence:CCGGGCTGGATGAACTACAGGACAACTCGAGTTGTCCTGTAGTTCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016796.3-345s21c1
Sequence:CCGGGCTGGATGAACTACAGGACAACTCGAGTTGTCCTGTAGTTCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016796.3-367s21c1
Sequence:CCGGTCAGAAAGCTTATCGGATAATCTCGAGATTATCCGATAAGCTTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016796.3-223s21c1
Sequence:CCGGGGACCATCTGGACCAAGATTTCTCGAGAAATCTTGGTCCAGATGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016796.3-714s21c1
Sequence:CCGGGGGTTCCTCCTCCATCATAACCTCGAGGTTATGATGGAGGAGGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016796.3-805s21c1
Sequence:CCGGAGTTTATAAGCTGGGAAATTTCTCGAGAAATTTCCCAGCTTATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016796.3-304s21c1
Sequence:GTACCGGATGCAAGAGAATATTACAAAGCTCGAGCTTTGTAATATTCTCTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016796.3-609s21c1
Sequence:GTACCGGTTAGTTGATGCCCAGTGAAATCTCGAGATTTCACTGGGCATCAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016796.3-411s21c1
Sequence:GTACCGGCAAACAGCTTCGAAGGCAAATCTCGAGATTTGCCTTCGAAGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016796
VALIDATED
VAMP4 MISSION shRNA Lentiviral Transduction Particles
vesicle-associated membrane protein 4
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016796.2-1397s1c1
Sequence:CCGGGCCATCTTAGTCCATACAAATCTCGAGATTTGTATGGACTAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016796.2-360s1c1
Sequence:CCGGCAGGACAAATCAGAAAGCTTACTCGAGTAAGCTTTCTGATTTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016796.2-391s1c1
Sequence:CCGGCCACCGCTTTCAGCAACAGATCTCGAGATCTGTTGCTGAAAGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016796.2-237s1c1
Sequence:CCGGCCAAGATTTGGACCTAGAAATCTCGAGATTTCTAGGTCCAAATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016796.2-347s1c1
Sequence:CCGGGCTGGATGAACTACAGGACAACTCGAGTTGTCCTGTAGTTCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016796.3-345s21c1
Sequence:CCGGGCTGGATGAACTACAGGACAACTCGAGTTGTCCTGTAGTTCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016796.3-367s21c1
Sequence:CCGGTCAGAAAGCTTATCGGATAATCTCGAGATTATCCGATAAGCTTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016796.3-223s21c1
Sequence:CCGGGGACCATCTGGACCAAGATTTCTCGAGAAATCTTGGTCCAGATGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016796.3-714s21c1
Sequence:CCGGGGGTTCCTCCTCCATCATAACCTCGAGGTTATGATGGAGGAGGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016796.3-805s21c1
Sequence:CCGGAGTTTATAAGCTGGGAAATTTCTCGAGAAATTTCCCAGCTTATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016796.3-304s21c1
Sequence:GTACCGGATGCAAGAGAATATTACAAAGCTCGAGCTTTGTAATATTCTCTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016796.3-609s21c1
Sequence:GTACCGGTTAGTTGATGCCCAGTGAAATCTCGAGATTTCACTGGGCATCAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016796.3-411s21c1
Sequence:GTACCGGCAAACAGCTTCGAAGGCAAATCTCGAGATTTGCCTTCGAAGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks