EMAIL THIS PAGE TO A FRIEND

VAMP5

vesicle-associated membrane protein 5

UniProtKB ID: O95183, Q9P0T2
Gene ID:
Human(10791) Summary: Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein are the main components of a protein complex involved in the docking and/or fusion of vesicles and cell membranes. The VAMP5 gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family and the SNARE superfamily. This VAMP family member may participate in vesicle trafficking events that are associated with myogenesis. [provided by RefSeq, Jul 2008]
Mouse(53620) vesicle-associated membrane protein 5
Rat(89818) vesicle-associated membrane protein 5
Zebrafish(325484) vesicle-associated membrane protein 5
dog(482823) vesicle-associated membrane protein 5
domestic cat(101091101) vesicle-associated membrane protein 5
cow(540406) vesicle-associated membrane protein 5 (myobrevin)
sheep(101102225) vesicle-associated membrane protein 5
naked mole-rat(101702506) vesicle-associated membrane protein 5
domestic guinea pig(100729995) vesicle-associated membrane protein 5
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006634 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006634 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006634 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016872 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016872 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016872 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001221 MISSION® esiRNA esiRNA targeting human VAMP5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006634 Rosetta Predictions human pricing
NM_053555 Rosetta Predictions rat pricing
NM_001080742 Rosetta Predictions mouse pricing
NM_016872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065450 predicted 268
2 SASI_Hs01_00065451 predicted 228
3 SASI_Hs01_00065452 predicted 238
4 SASI_Hs01_00065453 predicted 211
5 SASI_Hs01_00065454 predicted 433
6 SASI_Hs01_00065456 predicted 210
7 SASI_Hs01_00065457 predicted 217
8 SASI_Hs01_00065455 predicted 199
9 SASI_Hs01_00065458 predicted 518
10 SASI_Hs01_00065459 predicted 123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073796 predicted 45
2 SASI_Rn01_00073797 predicted 41
3 SASI_Rn01_00073798 predicted 177
4 SASI_Rn01_00073799 predicted 28
5 SASI_Rn01_00073800 predicted 133
6 SASI_Rn01_00073801 predicted 50
7 SASI_Rn01_00073802 predicted 47
8 SASI_Rn01_00073803 predicted 149
9 SASI_Rn01_00073804 predicted 254
10 SASI_Rn02_00266212 predicted 111
11 SASI_Rn01_00073805 predicted 181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293593 predicted 506
2 SASI_Mm02_00293594 predicted 836
3 SASI_Mm02_00293595 predicted 202
4 SASI_Mm02_00293596 predicted 418
5 SASI_Mm02_00293597 predicted 461
6 SASI_Mm02_00293598 predicted 894
7 SASI_Mm02_00293599 predicted 875
8 SASI_Mm02_00293600 predicted 887
9 SASI_Mm02_00293601 predicted 396
10 SASI_Mm02_00293602 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323670 predicted 617
2 SASI_Mm02_00323671 predicted 390
3 SASI_Mm01_00061755 predicted 440
4 SASI_Mm02_00323672 predicted 202
5 SASI_Mm02_00323673 predicted 525
6 SASI_Mm02_00323674 predicted 576
7 SASI_Mm02_00323675 predicted 524
8 SASI_Mm02_00323676 predicted 516
9 SASI_Mm02_00323677 predicted 128
10 SASI_Mm01_00061757 predicted 311
11 SASI_Mm01_00061756 predicted 365
12 SASI_Mm01_00061758 predicted 364
13 SASI_Mm01_00061759 predicted 322
14 SASI_Mm01_00061760 predicted 355
15 SASI_Mm01_00061761 predicted 262
16 SASI_Mm01_00061762 predicted 307
17 SASI_Mm01_00061763 predicted 309
18 SASI_Mm01_00061764 predicted 354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006634
VALIDATED
VAMP5 MISSION shRNA Bacterial Glycerol Stock
vesicle-associated membrane protein 5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-245s21c1
Sequence:CCGGTACACAGAACCTGGCCCAGAACTCGAGTTCTGGGCCAGGTTCTGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-120s21c1
Sequence:CCGGGCGAACGAGGTGACGGAAATTCTCGAGAATTTCCGTCACCTCGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-340s21c1
Sequence:CCGGTTGTGCTGCTGGTCGTCTTTCCTCGAGGAAAGACGACCAGCAGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-270s21c1
Sequence:CCGGTGCTGGGAGAACATCCGTTACCTCGAGGTAACGGATGTTCTCCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-206s21c1
Sequence:CCGGAGACCAACTCCTGGATATGAGCTCGAGCTCATATCCAGGAGTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-132s21c1
Sequence:CCGGACGGAAATTATGCGTAACAACCTCGAGGTTGTTACGCATAATTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-217s21c1
Sequence:CCGGTGGATATGAGCTCAACCTTCACTCGAGTGAAGGTTGAGCTCATATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-143s21c1
Sequence:CCGGGCGTAACAACTTCGGCAAGGTCTCGAGACCTTGCCGAAGTTGTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_006634.2-121s1c1
Sequence:CCGGCGAACGAGGTGACGGAAATTACTCGAGTAATTTCCGTCACCTCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_006634.2-131s1c1
Sequence:CCGGGACGGAAATTATGCGTAACAACTCGAGTTGTTACGCATAATTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_006634.2-233s1c1
Sequence:CCGGCTTCAACAAGACTACACAGAACTCGAGTTCTGTGTAGTCTTGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_006634.2-133s1c1
Sequence:CCGGCGGAAATTATGCGTAACAACTCTCGAGAGTTGTTACGCATAATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_006634.2-232s1c1
Sequence:CCGGCCTTCAACAAGACTACACAGACTCGAGTCTGTGTAGTCTTGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006634
VALIDATED
VAMP5 MISSION shRNA shRNA Plasmid DNA
vesicle-associated membrane protein 5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-245s21c1
Sequence:CCGGTACACAGAACCTGGCCCAGAACTCGAGTTCTGGGCCAGGTTCTGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-120s21c1
Sequence:CCGGGCGAACGAGGTGACGGAAATTCTCGAGAATTTCCGTCACCTCGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-340s21c1
Sequence:CCGGTTGTGCTGCTGGTCGTCTTTCCTCGAGGAAAGACGACCAGCAGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-270s21c1
Sequence:CCGGTGCTGGGAGAACATCCGTTACCTCGAGGTAACGGATGTTCTCCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-206s21c1
Sequence:CCGGAGACCAACTCCTGGATATGAGCTCGAGCTCATATCCAGGAGTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-132s21c1
Sequence:CCGGACGGAAATTATGCGTAACAACCTCGAGGTTGTTACGCATAATTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-217s21c1
Sequence:CCGGTGGATATGAGCTCAACCTTCACTCGAGTGAAGGTTGAGCTCATATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-143s21c1
Sequence:CCGGGCGTAACAACTTCGGCAAGGTCTCGAGACCTTGCCGAAGTTGTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_006634.2-121s1c1
Sequence:CCGGCGAACGAGGTGACGGAAATTACTCGAGTAATTTCCGTCACCTCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_006634.2-131s1c1
Sequence:CCGGGACGGAAATTATGCGTAACAACTCGAGTTGTTACGCATAATTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_006634.2-233s1c1
Sequence:CCGGCTTCAACAAGACTACACAGAACTCGAGTTCTGTGTAGTCTTGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_006634.2-133s1c1
Sequence:CCGGCGGAAATTATGCGTAACAACTCTCGAGAGTTGTTACGCATAATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_006634.2-232s1c1
Sequence:CCGGCCTTCAACAAGACTACACAGACTCGAGTCTGTGTAGTCTTGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006634
VALIDATED
VAMP5 MISSION shRNA Lentiviral Transduction Particles
vesicle-associated membrane protein 5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-245s21c1
Sequence:CCGGTACACAGAACCTGGCCCAGAACTCGAGTTCTGGGCCAGGTTCTGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-120s21c1
Sequence:CCGGGCGAACGAGGTGACGGAAATTCTCGAGAATTTCCGTCACCTCGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-340s21c1
Sequence:CCGGTTGTGCTGCTGGTCGTCTTTCCTCGAGGAAAGACGACCAGCAGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-270s21c1
Sequence:CCGGTGCTGGGAGAACATCCGTTACCTCGAGGTAACGGATGTTCTCCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-206s21c1
Sequence:CCGGAGACCAACTCCTGGATATGAGCTCGAGCTCATATCCAGGAGTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-132s21c1
Sequence:CCGGACGGAAATTATGCGTAACAACCTCGAGGTTGTTACGCATAATTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-217s21c1
Sequence:CCGGTGGATATGAGCTCAACCTTCACTCGAGTGAAGGTTGAGCTCATATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006634.2-143s21c1
Sequence:CCGGGCGTAACAACTTCGGCAAGGTCTCGAGACCTTGCCGAAGTTGTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_006634.2-121s1c1
Sequence:CCGGCGAACGAGGTGACGGAAATTACTCGAGTAATTTCCGTCACCTCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_006634.2-131s1c1
Sequence:CCGGGACGGAAATTATGCGTAACAACTCGAGTTGTTACGCATAATTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_006634.2-233s1c1
Sequence:CCGGCTTCAACAAGACTACACAGAACTCGAGTTCTGTGTAGTCTTGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_006634.2-133s1c1
Sequence:CCGGCGGAAATTATGCGTAACAACTCTCGAGAGTTGTTACGCATAATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_006634.2-232s1c1
Sequence:CCGGCCTTCAACAAGACTACACAGACTCGAGTCTGTGTAGTCTTGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016872
VALIDATED
VAMP5 MISSION shRNA Bacterial Glycerol Stock
vesicle-associated membrane protein 5
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016872.3-766s21c1
Sequence:GTACCGGAGACACCAGACATAGGCATTACTCGAGTAATGCCTATGTCTGGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016872.3-322s21c1
Sequence:GTACCGGTGGCCTGCTCATCATCCTGATCTCGAGATCAGGATGATGAGCAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016872.3-344s21c1
Sequence:CCGGGTGTTGCTGGTCGTCTTTCTTCTCGAGAAGAAAGACGACCAGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016872.3-135s21c1
Sequence:CCGGCGGAAATCATGCTCAACAATTCTCGAGAATTGTTGAGCATGATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016872.3-238s21c1
Sequence:CCGGCAGCAAGACAACCAAGACTTTCTCGAGAAAGTCTTGGTTGTCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016872.3-392s21c1
Sequence:CCGGTAGGCCTAGGATGCAGGTGATCTCGAGATCACCTGCATCCTAGGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016872.3-854s21c1
Sequence:CCGGTGTAGCACAAACATACTATATCTCGAGATATAGTATGTTTGTGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016872.3-535s21c1
Sequence:GTACCGGTGAAGGGCATCCAGGATTATGCTCGAGCATAATCCTGGATGCCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016872.1-162s1c1
Sequence:CCGGCAGCAAGACAACCAAGACTTTCTCGAGAAAGTCTTGGTTGTCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016872.1-59s1c1
Sequence:CCGGCGGAAATCATGCTCAACAATTCTCGAGAATTGTTGAGCATGATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016872.1-174s1c1
Sequence:CCGGCAAGACTTTAGCCCAGCAGAACTCGAGTTCTGCTGGGCTAAAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016872.1-268s1c1
Sequence:CCGGGTGTTGCTGGTCGTCTTTCTTCTCGAGAAGAAAGACGACCAGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016872
VALIDATED
VAMP5 MISSION shRNA shRNA Plasmid DNA
vesicle-associated membrane protein 5
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016872.3-766s21c1
Sequence:GTACCGGAGACACCAGACATAGGCATTACTCGAGTAATGCCTATGTCTGGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016872.3-322s21c1
Sequence:GTACCGGTGGCCTGCTCATCATCCTGATCTCGAGATCAGGATGATGAGCAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016872.3-344s21c1
Sequence:CCGGGTGTTGCTGGTCGTCTTTCTTCTCGAGAAGAAAGACGACCAGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016872.3-135s21c1
Sequence:CCGGCGGAAATCATGCTCAACAATTCTCGAGAATTGTTGAGCATGATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016872.3-238s21c1
Sequence:CCGGCAGCAAGACAACCAAGACTTTCTCGAGAAAGTCTTGGTTGTCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016872.3-392s21c1
Sequence:CCGGTAGGCCTAGGATGCAGGTGATCTCGAGATCACCTGCATCCTAGGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016872.3-854s21c1
Sequence:CCGGTGTAGCACAAACATACTATATCTCGAGATATAGTATGTTTGTGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016872.3-535s21c1
Sequence:GTACCGGTGAAGGGCATCCAGGATTATGCTCGAGCATAATCCTGGATGCCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016872.1-162s1c1
Sequence:CCGGCAGCAAGACAACCAAGACTTTCTCGAGAAAGTCTTGGTTGTCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016872.1-59s1c1
Sequence:CCGGCGGAAATCATGCTCAACAATTCTCGAGAATTGTTGAGCATGATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016872.1-174s1c1
Sequence:CCGGCAAGACTTTAGCCCAGCAGAACTCGAGTTCTGCTGGGCTAAAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016872.1-268s1c1
Sequence:CCGGGTGTTGCTGGTCGTCTTTCTTCTCGAGAAGAAAGACGACCAGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016872
VALIDATED
VAMP5 MISSION shRNA Lentiviral Transduction Particles
vesicle-associated membrane protein 5
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016872.3-766s21c1
Sequence:GTACCGGAGACACCAGACATAGGCATTACTCGAGTAATGCCTATGTCTGGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016872.3-322s21c1
Sequence:GTACCGGTGGCCTGCTCATCATCCTGATCTCGAGATCAGGATGATGAGCAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016872.3-344s21c1
Sequence:CCGGGTGTTGCTGGTCGTCTTTCTTCTCGAGAAGAAAGACGACCAGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016872.3-135s21c1
Sequence:CCGGCGGAAATCATGCTCAACAATTCTCGAGAATTGTTGAGCATGATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016872.3-238s21c1
Sequence:CCGGCAGCAAGACAACCAAGACTTTCTCGAGAAAGTCTTGGTTGTCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016872.3-392s21c1
Sequence:CCGGTAGGCCTAGGATGCAGGTGATCTCGAGATCACCTGCATCCTAGGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016872.3-854s21c1
Sequence:CCGGTGTAGCACAAACATACTATATCTCGAGATATAGTATGTTTGTGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016872.3-535s21c1
Sequence:GTACCGGTGAAGGGCATCCAGGATTATGCTCGAGCATAATCCTGGATGCCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016872.1-162s1c1
Sequence:CCGGCAGCAAGACAACCAAGACTTTCTCGAGAAAGTCTTGGTTGTCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016872.1-59s1c1
Sequence:CCGGCGGAAATCATGCTCAACAATTCTCGAGAATTGTTGAGCATGATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016872.1-174s1c1
Sequence:CCGGCAAGACTTTAGCCCAGCAGAACTCGAGTTCTGCTGGGCTAAAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016872.1-268s1c1
Sequence:CCGGGTGTTGCTGGTCGTCTTTCTTCTCGAGAAGAAAGACGACCAGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks