EMAIL THIS PAGE TO A FRIEND

VAMP7

vesicle-associated membrane protein 7

Synonyms: SYBL1 TI-VAMP TIVAMP VAMP-7
UniProtKB ID: P51809, Q53GY7, Q7Z409, Q9H4A7
Gene ID:
Human(6845) Summary: This gene encodes a transmembrane protein that is a member of the soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) family. The encoded protein localizes to late endosomes and lysosomes and is involved in the fusion of transport vesicles to their target membranes. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2010]
Mouse(20955) vesicle-associated membrane protein 7
Rat(85491) vesicle-associated membrane protein 7
domestic guinea pig(100718902) vesicle-associated membrane protein 7
cow(613984) vesicle-associated membrane protein 7
sheep(100307050) vesicle-associated membrane protein 7
chicken(422297) vesicle-associated membrane protein 7
dog(612663) vesicle-associated membrane protein 7
domestic cat(101095160) vesicle-associated membrane protein 7
177 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036733 Anti-VAMP7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2106779 Anti-VAMP7 antibody produced in rabbit affinity isolated antibody human, guinea pig, horse, sheep, rabbit, mouse
ELISA, western blot pricing
SAB2105695 Anti-VAMP7, (N-terminal) antibody produced in rabbit affinity isolated antibody sheep, human, rabbit, guinea pig, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011515 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011515 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011515 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005638 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005638 Rosetta Predictions human pricing
NM_053531 Rosetta Predictions rat pricing
NM_011515 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197188 predicted 568
2 SASI_Hs01_00197189 predicted 844
3 SASI_Hs01_00197190 predicted 367
4 SASI_Hs01_00197191 predicted 463
5 SASI_Hs01_00197192 predicted 318
6 SASI_Hs01_00197193 predicted 367
7 SASI_Hs01_00197195 predicted 788
8 SASI_Hs01_00197196 predicted 843
9 SASI_Hs01_00197197 predicted 466
10 SASI_Hs02_00339975 predicted 397
11 SASI_Hs01_00197194 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099697 predicted 291
2 SASI_Rn01_00099698 predicted 320
3 SASI_Rn01_00099699 predicted 213
4 SASI_Rn01_00099700 predicted 260
5 SASI_Rn01_00099701 predicted 328
6 SASI_Rn01_00099702 predicted 378
7 SASI_Rn01_00099703 predicted 420
8 SASI_Rn01_00099704 predicted 318
9 SASI_Rn01_00099705 predicted 264
10 SASI_Rn01_00099706 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034269 predicted 510
2 SASI_Mm01_00034270 predicted 376
3 SASI_Mm01_00034271 predicted 257
4 SASI_Mm01_00034272 predicted 593
5 SASI_Mm01_00034273 predicted 591
6 SASI_Mm01_00034274 predicted 391
7 SASI_Mm01_00034275 predicted 308
8 SASI_Mm01_00034276 predicted 501
9 SASI_Mm01_00034277 predicted 1279
10 SASI_Mm01_00034278 predicted 1279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011515
VALIDATED
VAMP7 MISSION shRNA Bacterial Glycerol Stock
vesicle-associated membrane protein 7
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011515.1-940s1c1
Sequence:CCGGCCTGTCATATAGTTTGTGTTACTCGAGTAACACAAACTATATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011515.1-671s1c1
Sequence:CCGGTCGAGCCATGTGTATGAAGAACTCGAGTTCTTCATACACATGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011515.1-525s1c1
Sequence:CCGGGCACAAGTGGATGAACTGAAACTCGAGTTTCAGTTCATCCACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011515.1-265s1c1
Sequence:CCGGCTTACTCACATGGCAATTATTCTCGAGAATAATTGCCATGTGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011515.1-423s1c1
Sequence:CCGGGCACTTCCTTATGCTATGAATCTCGAGATTCATAGCATAAGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011515.4-493s21c1
Sequence:GTACCGGTAAGAGCCTAGACAAAGTGATCTCGAGATCACTTTGTCTAGGCTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011515.4-467s21c1
Sequence:GTACCGGGCACAACTGAAGCATCACTCTCTCGAGAGAGTGATGCTTCAGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011515.4-934s21c1
Sequence:CCGGCTTTGCCTGTCATATAGTTTGCTCGAGCAAACTATATGACAGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011515.4-524s21c1
Sequence:CCGGGCACAAGTGGATGAACTGAAACTCGAGTTTCAGTTCATCCACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011515.4-321s21c1
Sequence:CCGGTTTGTATCACTGATGATGATTCTCGAGAATCATCATCAGTGATACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011515.4-400s21c1
Sequence:CCGGTTACGGTTCAAGAGCACAAACCTCGAGGTTTGTGCTCTTGAACCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011515.4-422s21c1
Sequence:CCGGGCACTTCCTTATGCTATGAATCTCGAGATTCATAGCATAAGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011515
VALIDATED
VAMP7 MISSION shRNA shRNA Plasmid DNA
vesicle-associated membrane protein 7
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011515.1-940s1c1
Sequence:CCGGCCTGTCATATAGTTTGTGTTACTCGAGTAACACAAACTATATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011515.1-671s1c1
Sequence:CCGGTCGAGCCATGTGTATGAAGAACTCGAGTTCTTCATACACATGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011515.1-525s1c1
Sequence:CCGGGCACAAGTGGATGAACTGAAACTCGAGTTTCAGTTCATCCACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011515.1-265s1c1
Sequence:CCGGCTTACTCACATGGCAATTATTCTCGAGAATAATTGCCATGTGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011515.1-423s1c1
Sequence:CCGGGCACTTCCTTATGCTATGAATCTCGAGATTCATAGCATAAGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011515.4-493s21c1
Sequence:GTACCGGTAAGAGCCTAGACAAAGTGATCTCGAGATCACTTTGTCTAGGCTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011515.4-467s21c1
Sequence:GTACCGGGCACAACTGAAGCATCACTCTCTCGAGAGAGTGATGCTTCAGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011515.4-934s21c1
Sequence:CCGGCTTTGCCTGTCATATAGTTTGCTCGAGCAAACTATATGACAGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011515.4-524s21c1
Sequence:CCGGGCACAAGTGGATGAACTGAAACTCGAGTTTCAGTTCATCCACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011515.4-321s21c1
Sequence:CCGGTTTGTATCACTGATGATGATTCTCGAGAATCATCATCAGTGATACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011515.4-400s21c1
Sequence:CCGGTTACGGTTCAAGAGCACAAACCTCGAGGTTTGTGCTCTTGAACCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011515.4-422s21c1
Sequence:CCGGGCACTTCCTTATGCTATGAATCTCGAGATTCATAGCATAAGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011515
VALIDATED
VAMP7 MISSION shRNA Lentiviral Transduction Particles
vesicle-associated membrane protein 7
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011515.1-940s1c1
Sequence:CCGGCCTGTCATATAGTTTGTGTTACTCGAGTAACACAAACTATATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011515.1-671s1c1
Sequence:CCGGTCGAGCCATGTGTATGAAGAACTCGAGTTCTTCATACACATGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011515.1-525s1c1
Sequence:CCGGGCACAAGTGGATGAACTGAAACTCGAGTTTCAGTTCATCCACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011515.1-265s1c1
Sequence:CCGGCTTACTCACATGGCAATTATTCTCGAGAATAATTGCCATGTGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011515.1-423s1c1
Sequence:CCGGGCACTTCCTTATGCTATGAATCTCGAGATTCATAGCATAAGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011515.4-493s21c1
Sequence:GTACCGGTAAGAGCCTAGACAAAGTGATCTCGAGATCACTTTGTCTAGGCTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011515.4-467s21c1
Sequence:GTACCGGGCACAACTGAAGCATCACTCTCTCGAGAGAGTGATGCTTCAGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011515.4-934s21c1
Sequence:CCGGCTTTGCCTGTCATATAGTTTGCTCGAGCAAACTATATGACAGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011515.4-524s21c1
Sequence:CCGGGCACAAGTGGATGAACTGAAACTCGAGTTTCAGTTCATCCACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011515.4-321s21c1
Sequence:CCGGTTTGTATCACTGATGATGATTCTCGAGAATCATCATCAGTGATACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011515.4-400s21c1
Sequence:CCGGTTACGGTTCAAGAGCACAAACCTCGAGGTTTGTGCTCTTGAACCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011515.4-422s21c1
Sequence:CCGGGCACTTCCTTATGCTATGAATCTCGAGATTCATAGCATAAGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005638
VALIDATED
VAMP7 MISSION shRNA Bacterial Glycerol Stock
vesicle-associated membrane protein 7
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005638.3-561s1c1
Sequence:CCGGGCGAGGAGAAAGATTGGAATTCTCGAGAATTCCAATCTTTCTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_005638.3-403s1c1
Sequence:CCGGGCACTTCCATATGCCATGAATCTCGAGATTCATGGCATATGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005638.3-245s1c1
Sequence:CCGGCGTACTCACATGGCAATTATTCTCGAGAATAATTGCCATGTGAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_005638.3-202s1c1
Sequence:CCGGGAGCAGATTCTGGCTAAGATACTCGAGTATCTTAGCCAGAATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005638.3-678s1c1
Sequence:CCGGGCTCACTATTATCATCATCATCTCGAGATGATGATGATAATAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-867s21c1
Sequence:GTACCGGATGAGAGAACAAGGAGTTAAACTCGAGTTTAACTCCTTGTTCTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-530s21c1
Sequence:GTACCGGAGAATAAGGGCCTAGACAAAGCTCGAGCTTTGTCTAGGCCCTTATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-621s21c1
Sequence:CCGGGCGAGGAGAAAGATTGGAATTCTCGAGAATTCCAATCTTTCTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-837s21c1
Sequence:CCGGGGAAAGAAGAAGTTACCATTACTCGAGTAATGGTAACTTCTTCTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-363s21c1
Sequence:CCGGTTGTATCACTGATGATGATTTCTCGAGAAATCATCATCAGTGATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-1157s21c1
Sequence:CCGGTCTTATGAGCTATCTACTAAACTCGAGTTTAGTAGATAGCTCATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-485s21c1
Sequence:CCGGGCGAGTTCTCAAGTGTCTTAGCTCGAGCTAAGACACTTGAGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005638
VALIDATED
VAMP7 MISSION shRNA shRNA Plasmid DNA
vesicle-associated membrane protein 7
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005638.3-561s1c1
Sequence:CCGGGCGAGGAGAAAGATTGGAATTCTCGAGAATTCCAATCTTTCTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_005638.3-403s1c1
Sequence:CCGGGCACTTCCATATGCCATGAATCTCGAGATTCATGGCATATGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005638.3-245s1c1
Sequence:CCGGCGTACTCACATGGCAATTATTCTCGAGAATAATTGCCATGTGAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_005638.3-202s1c1
Sequence:CCGGGAGCAGATTCTGGCTAAGATACTCGAGTATCTTAGCCAGAATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005638.3-678s1c1
Sequence:CCGGGCTCACTATTATCATCATCATCTCGAGATGATGATGATAATAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-867s21c1
Sequence:GTACCGGATGAGAGAACAAGGAGTTAAACTCGAGTTTAACTCCTTGTTCTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-530s21c1
Sequence:GTACCGGAGAATAAGGGCCTAGACAAAGCTCGAGCTTTGTCTAGGCCCTTATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-621s21c1
Sequence:CCGGGCGAGGAGAAAGATTGGAATTCTCGAGAATTCCAATCTTTCTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-837s21c1
Sequence:CCGGGGAAAGAAGAAGTTACCATTACTCGAGTAATGGTAACTTCTTCTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-363s21c1
Sequence:CCGGTTGTATCACTGATGATGATTTCTCGAGAAATCATCATCAGTGATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-1157s21c1
Sequence:CCGGTCTTATGAGCTATCTACTAAACTCGAGTTTAGTAGATAGCTCATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-485s21c1
Sequence:CCGGGCGAGTTCTCAAGTGTCTTAGCTCGAGCTAAGACACTTGAGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005638
VALIDATED
VAMP7 MISSION shRNA Lentiviral Transduction Particles
vesicle-associated membrane protein 7
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005638.3-561s1c1
Sequence:CCGGGCGAGGAGAAAGATTGGAATTCTCGAGAATTCCAATCTTTCTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_005638.3-403s1c1
Sequence:CCGGGCACTTCCATATGCCATGAATCTCGAGATTCATGGCATATGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005638.3-245s1c1
Sequence:CCGGCGTACTCACATGGCAATTATTCTCGAGAATAATTGCCATGTGAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_005638.3-202s1c1
Sequence:CCGGGAGCAGATTCTGGCTAAGATACTCGAGTATCTTAGCCAGAATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005638.3-678s1c1
Sequence:CCGGGCTCACTATTATCATCATCATCTCGAGATGATGATGATAATAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-867s21c1
Sequence:GTACCGGATGAGAGAACAAGGAGTTAAACTCGAGTTTAACTCCTTGTTCTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-530s21c1
Sequence:GTACCGGAGAATAAGGGCCTAGACAAAGCTCGAGCTTTGTCTAGGCCCTTATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-621s21c1
Sequence:CCGGGCGAGGAGAAAGATTGGAATTCTCGAGAATTCCAATCTTTCTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-837s21c1
Sequence:CCGGGGAAAGAAGAAGTTACCATTACTCGAGTAATGGTAACTTCTTCTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-363s21c1
Sequence:CCGGTTGTATCACTGATGATGATTTCTCGAGAAATCATCATCAGTGATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-1157s21c1
Sequence:CCGGTCTTATGAGCTATCTACTAAACTCGAGTTTAGTAGATAGCTCATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005638.4-485s21c1
Sequence:CCGGGCGAGTTCTCAAGTGTCTTAGCTCGAGCTAAGACACTTGAGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks