EMAIL THIS PAGE TO A FRIEND

VAMP8

vesicle-associated membrane protein 8

Synonyms: EDB VAMP-8
UniProtKB ID: Q9BV40, O60625, Q53SP9, Q6IB09
Gene ID:
Human(8673) Summary: This gene encodes an integral membrane protein that belongs to the synaptobrevin/vesicle-associated membrane protein subfamily of soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs). The encoded protein is involved in the fusion of synaptic vesicles with the presynaptic membrane.[provided by RefSeq, Jun 2010]
Mouse(22320) vesicle-associated membrane protein 8
Rat(83730) vesicle-associated membrane protein 8
Zebrafish(327007) vesicle-associated membrane protein 8 (endobrevin)
domestic cat(101085880) vesicle-associated membrane protein 8
dog(609784) vesicle-associated membrane protein 8
cow(507309) vesicle-associated membrane protein 8 (endobrevin)
sheep(101102633) vesicle-associated membrane protein 8
domestic guinea pig(100728978) vesicle-associated membrane protein 8
naked mole-rat(101703109) vesicle-associated membrane protein 8
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0255 AQUA Peptide TEDLEATSEHF[K] cow, dog, human, mouse, rat pricing
AQ0254 AQUA Peptide NLQSEVEGV[K] dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016794 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016794 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016794 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003761 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003761 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003761 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003761 Rosetta Predictions human pricing
NM_031827 Rosetta Predictions rat pricing
NM_016794 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336242 predicted 454
2 SASI_Hs01_00159294 predicted 350
3 SASI_Hs02_00336243 predicted 199
4 SASI_Hs01_00159296 predicted 355
5 SASI_Hs01_00159297 predicted 278
6 SASI_Hs02_00336244 predicted 467
7 SASI_Hs02_00336245 predicted 402
8 SASI_Hs01_00159300 predicted 349
9 SASI_Hs02_00336246 predicted 275
10 SASI_Hs02_00336247 predicted 269
11 SASI_Hs01_00159293 predicted 251
12 SASI_Hs01_00159295 predicted 244
13 SASI_Hs01_00159298 predicted 240
14 SASI_Hs01_00159299 predicted 315
15 SASI_Hs01_00159301 predicted 256
16 SASI_Hs01_00159302 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031827 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112721 predicted 75
2 SASI_Rn01_00112722 predicted 231
3 SASI_Rn01_00112723 predicted 174
4 SASI_Rn01_00112724 predicted 220
5 SASI_Rn02_00265304 predicted 42
6 SASI_Rn01_00112725 predicted 110
7 SASI_Rn01_00112726 predicted 18
8 SASI_Rn01_00112727 predicted 145
9 SASI_Rn01_00112728 predicted 234
10 SASI_Rn02_00265305 predicted 144
11 SASI_Rn01_00112729 predicted 37
12 SASI_Rn01_00112730 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101526 predicted 347
2 SASI_Mm01_00101527 predicted 297
3 SASI_Mm01_00101528 predicted 355
4 SASI_Mm01_00101529 predicted 371
5 SASI_Mm01_00101530 predicted 374
6 SASI_Mm01_00101531 predicted 342
7 SASI_Mm01_00101532 predicted 276
8 SASI_Mm01_00101533 predicted 272
9 SASI_Mm01_00101534 predicted 230
10 SASI_Mm01_00101535 predicted 270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016794
VALIDATED
VAMP8 MISSION shRNA Bacterial Glycerol Stock
vesicle-associated membrane protein 8
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016794.3-262s21c1
Sequence:CCGGAGAATATTATGACCCAGAATGCTCGAGCATTCTGGGTCATAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016794.2-460s21c1
Sequence:CCGGCCTCCCTAATATGTGCCAAGACTCGAGTCTTGGCACATATTAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016794.2-315s21c1
Sequence:CCGGCCGGAAGTTCTGGTGGAAGAACTCGAGTTCTTCCACCAGAACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016794.2-275s21c1
Sequence:CCGGCCACGTCTGAACACTTCAAGACTCGAGTCTTGAAGTGTTCAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016794.2-175s21c1
Sequence:CCGGGTGGAGGGAGTCAAGAATATTCTCGAGAATATTCTTGACTCCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016794.2-357s21c1
Sequence:CCGGCTGTGTGATTGTCCTTATCATCTCGAGATGATAAGGACAATCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016794.2-460s1c1
Sequence:CCGGCCTCCCTAATATGTGCCAAGACTCGAGTCTTGGCACATATTAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016794.2-315s1c1
Sequence:CCGGCCGGAAGTTCTGGTGGAAGAACTCGAGTTCTTCCACCAGAACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016794.2-357s1c1
Sequence:CCGGCTGTGTGATTGTCCTTATCATCTCGAGATGATAAGGACAATCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016794.2-275s1c1
Sequence:CCGGCCACGTCTGAACACTTCAAGACTCGAGTCTTGAAGTGTTCAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016794.2-278s1c1
Sequence:CCGGCGTCTGAACACTTCAAGACAACTCGAGTTGTCTTGAAGTGTTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016794
VALIDATED
VAMP8 MISSION shRNA shRNA Plasmid DNA
vesicle-associated membrane protein 8
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016794.3-262s21c1
Sequence:CCGGAGAATATTATGACCCAGAATGCTCGAGCATTCTGGGTCATAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016794.2-460s21c1
Sequence:CCGGCCTCCCTAATATGTGCCAAGACTCGAGTCTTGGCACATATTAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016794.2-315s21c1
Sequence:CCGGCCGGAAGTTCTGGTGGAAGAACTCGAGTTCTTCCACCAGAACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016794.2-275s21c1
Sequence:CCGGCCACGTCTGAACACTTCAAGACTCGAGTCTTGAAGTGTTCAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016794.2-175s21c1
Sequence:CCGGGTGGAGGGAGTCAAGAATATTCTCGAGAATATTCTTGACTCCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016794.2-357s21c1
Sequence:CCGGCTGTGTGATTGTCCTTATCATCTCGAGATGATAAGGACAATCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016794.2-460s1c1
Sequence:CCGGCCTCCCTAATATGTGCCAAGACTCGAGTCTTGGCACATATTAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016794.2-315s1c1
Sequence:CCGGCCGGAAGTTCTGGTGGAAGAACTCGAGTTCTTCCACCAGAACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016794.2-357s1c1
Sequence:CCGGCTGTGTGATTGTCCTTATCATCTCGAGATGATAAGGACAATCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016794.2-275s1c1
Sequence:CCGGCCACGTCTGAACACTTCAAGACTCGAGTCTTGAAGTGTTCAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016794.2-278s1c1
Sequence:CCGGCGTCTGAACACTTCAAGACAACTCGAGTTGTCTTGAAGTGTTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016794
VALIDATED
VAMP8 MISSION shRNA Lentiviral Transduction Particles
vesicle-associated membrane protein 8
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016794.3-262s21c1
Sequence:CCGGAGAATATTATGACCCAGAATGCTCGAGCATTCTGGGTCATAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016794.2-460s21c1
Sequence:CCGGCCTCCCTAATATGTGCCAAGACTCGAGTCTTGGCACATATTAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016794.2-315s21c1
Sequence:CCGGCCGGAAGTTCTGGTGGAAGAACTCGAGTTCTTCCACCAGAACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016794.2-275s21c1
Sequence:CCGGCCACGTCTGAACACTTCAAGACTCGAGTCTTGAAGTGTTCAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016794.2-175s21c1
Sequence:CCGGGTGGAGGGAGTCAAGAATATTCTCGAGAATATTCTTGACTCCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016794.2-357s21c1
Sequence:CCGGCTGTGTGATTGTCCTTATCATCTCGAGATGATAAGGACAATCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016794.2-460s1c1
Sequence:CCGGCCTCCCTAATATGTGCCAAGACTCGAGTCTTGGCACATATTAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016794.2-315s1c1
Sequence:CCGGCCGGAAGTTCTGGTGGAAGAACTCGAGTTCTTCCACCAGAACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016794.2-357s1c1
Sequence:CCGGCTGTGTGATTGTCCTTATCATCTCGAGATGATAAGGACAATCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016794.2-275s1c1
Sequence:CCGGCCACGTCTGAACACTTCAAGACTCGAGTCTTGAAGTGTTCAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016794.2-278s1c1
Sequence:CCGGCGTCTGAACACTTCAAGACAACTCGAGTTGTCTTGAAGTGTTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003761
VALIDATED
VAMP8 MISSION shRNA Bacterial Glycerol Stock
vesicle-associated membrane protein 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003761.3-460s1c1
Sequence:CCGGCAGGGACAACCCTCCATAAATCTCGAGATTTATGGAGGGTTGTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003761.3-174s1c1
Sequence:CCGGAGTGAGGTGGAGGGAGTTAAGCTCGAGCTTAACTCCCTCCACCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003761.3-270s21c1
Sequence:CCGGGATCTGGAAGCCACATCTGAGCTCGAGCTCAGATGTGGCTTCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003761.3-405s21c1
Sequence:CCGGGCCACTGGTGCCTTCTCTTAACTCGAGTTAAGAGAAGGCACCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003761.3-148s21c1
Sequence:CCGGGAAATGATCGTGTGCGGAACCCTCGAGGGTTCCGCACACGATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003761.3-482s21c1
Sequence:CCGGTGTGCCAAGAGGGTCTCCTTTCTCGAGAAAGGAGACCCTCTTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003761.3-326s21c1
Sequence:CCGGATTCTGGTGGAAGAACGTGAACTCGAGTTCACGTTCTTCCACCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003761.2-224s1c1
Sequence:CCGGCTTCAAGACGACATCGCAGAACTCGAGTTCTGCGATGTCGTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003761.2-281s1c1
Sequence:CCGGGATTGTCCTTATCTGCGTGATCTCGAGATCACGCAGATAAGGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003761.2-173s1c1
Sequence:CCGGCTTGGAACATCTCCGCAACAACTCGAGTTGTTGCGGAGATGTTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003761
VALIDATED
VAMP8 MISSION shRNA shRNA Plasmid DNA
vesicle-associated membrane protein 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003761.3-460s1c1
Sequence:CCGGCAGGGACAACCCTCCATAAATCTCGAGATTTATGGAGGGTTGTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003761.3-174s1c1
Sequence:CCGGAGTGAGGTGGAGGGAGTTAAGCTCGAGCTTAACTCCCTCCACCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003761.3-270s21c1
Sequence:CCGGGATCTGGAAGCCACATCTGAGCTCGAGCTCAGATGTGGCTTCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003761.3-405s21c1
Sequence:CCGGGCCACTGGTGCCTTCTCTTAACTCGAGTTAAGAGAAGGCACCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003761.3-148s21c1
Sequence:CCGGGAAATGATCGTGTGCGGAACCCTCGAGGGTTCCGCACACGATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003761.3-482s21c1
Sequence:CCGGTGTGCCAAGAGGGTCTCCTTTCTCGAGAAAGGAGACCCTCTTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003761.3-326s21c1
Sequence:CCGGATTCTGGTGGAAGAACGTGAACTCGAGTTCACGTTCTTCCACCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003761.2-224s1c1
Sequence:CCGGCTTCAAGACGACATCGCAGAACTCGAGTTCTGCGATGTCGTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003761.2-281s1c1
Sequence:CCGGGATTGTCCTTATCTGCGTGATCTCGAGATCACGCAGATAAGGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003761.2-173s1c1
Sequence:CCGGCTTGGAACATCTCCGCAACAACTCGAGTTGTTGCGGAGATGTTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003761
VALIDATED
VAMP8 MISSION shRNA Lentiviral Transduction Particles
vesicle-associated membrane protein 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003761.3-460s1c1
Sequence:CCGGCAGGGACAACCCTCCATAAATCTCGAGATTTATGGAGGGTTGTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003761.3-174s1c1
Sequence:CCGGAGTGAGGTGGAGGGAGTTAAGCTCGAGCTTAACTCCCTCCACCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003761.3-270s21c1
Sequence:CCGGGATCTGGAAGCCACATCTGAGCTCGAGCTCAGATGTGGCTTCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003761.3-405s21c1
Sequence:CCGGGCCACTGGTGCCTTCTCTTAACTCGAGTTAAGAGAAGGCACCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003761.3-148s21c1
Sequence:CCGGGAAATGATCGTGTGCGGAACCCTCGAGGGTTCCGCACACGATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003761.3-482s21c1
Sequence:CCGGTGTGCCAAGAGGGTCTCCTTTCTCGAGAAAGGAGACCCTCTTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003761.3-326s21c1
Sequence:CCGGATTCTGGTGGAAGAACGTGAACTCGAGTTCACGTTCTTCCACCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003761.2-224s1c1
Sequence:CCGGCTTCAAGACGACATCGCAGAACTCGAGTTCTGCGATGTCGTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003761.2-281s1c1
Sequence:CCGGGATTGTCCTTATCTGCGTGATCTCGAGATCACGCAGATAAGGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003761.2-173s1c1
Sequence:CCGGCTTGGAACATCTCCGCAACAACTCGAGTTGTTGCGGAGATGTTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks