EMAIL THIS PAGE TO A FRIEND

VANGL1

VANGL planar cell polarity protein 1

Synonyms: KITENIN LPP2 STB2 STBM2
UniProtKB ID: Q8TAA9, Q5T1D3, Q5T1D4, Q86WG8, Q8N559
Gene ID:
Human(81839) Summary: This gene encodes a member of the tretraspanin family. The encoded protein may be involved in mediating intestinal trefoil factor induced wound healing in the intestinal mucosa. Mutations in this gene are associated with neural tube defects. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Mouse(229658) vang-like 1 (van gogh, Drosophila)
Rat(690366) VANGL planar cell polarity protein 1
Zebrafish(403076) vang-like 1 (van gogh, Drosophila)
chicken(418337) vang-like 1 (van gogh, Drosophila)
dog(483133) vang-like 1 (van gogh, Drosophila)
domestic cat(101082425) vang-like 1 (van gogh, Drosophila)
Horse(100059585) vang-like 1 (van gogh, Drosophila)
naked mole-rat(101723140) VANGL planar cell polarity protein 1
Domestic Rabbit(100342211) vang-like 1 (van gogh, Drosophila)
domestic guinea pig(100722497) VANGL planar cell polarity protein 1
cow(513056) vang-like 1 (van gogh, Drosophila)
sheep(101105039) vang-like 1 (van gogh, Drosophila)
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138959 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177545 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177545 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177545 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138959 Rosetta Predictions human pricing
NM_001109584 Rosetta Predictions rat pricing
NM_177545 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364007 predicted 731
2 SASI_Hs02_00364008 predicted 272
3 SASI_Hs02_00364009 predicted 852
4 SASI_Hs01_00137986 predicted 403
5 SASI_Hs02_00364010 predicted 1327
6 SASI_Hs01_00137988 predicted 1309
7 SASI_Hs01_00137991 predicted 746
8 SASI_Hs01_00137992 predicted 303
9 SASI_Hs01_00137993 predicted 926
10 SASI_Hs02_00364011 predicted 440
11 SASI_Hs01_00137984 predicted 349
12 SASI_Hs01_00137985 predicted 1093
13 SASI_Hs01_00137987 predicted 1180
14 SASI_Hs01_00137989 predicted 1128
15 SASI_Hs01_00137990 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249821 predicted 638
2 SASI_Rn02_00249822 predicted 1167
3 SASI_Rn02_00249823 predicted 770
4 SASI_Rn02_00249824 predicted 1273
5 SASI_Rn02_00249825 predicted 664
6 SASI_Rn02_00249826 predicted 300
7 SASI_Rn02_00249827 predicted 798
8 SASI_Rn02_00249828 predicted 2185
9 SASI_Rn02_00249829 predicted 1139
10 SASI_Rn02_00249830 predicted 2142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132760 predicted 773
2 SASI_Mm01_00132761 predicted 633
3 SASI_Mm01_00132762 predicted 246
4 SASI_Mm02_00347695 predicted 778
5 SASI_Mm02_00347696 predicted 299
6 SASI_Mm01_00132763 predicted 1147
7 SASI_Mm01_00132764 predicted 1165
8 SASI_Mm02_00347697 predicted 871
9 SASI_Mm01_00132765 predicted 1090
10 SASI_Mm01_00132766 predicted 688
11 SASI_Mm01_00132767 predicted 1137
12 SASI_Mm01_00132768 predicted 681
13 SASI_Mm01_00132769 predicted 227
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138959
VALIDATED
VANGL1 MISSION shRNA Bacterial Glycerol Stock
VANGL planar cell polarity protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138959.1-1056s1c1
Sequence:CCGGCGAACATGAACGGCGAGTAAACTCGAGTTTACTCGCCGTTCATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138959.1-465s1c1
Sequence:CCGGGCTCTTTATCTCCATGGCATTCTCGAGAATGCCATGGAGATAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138959.1-1504s1c1
Sequence:CCGGCCATTCATCATACTCTCTGAACTCGAGTTCAGAGAGTATGATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_138959.1-1480s1c1
Sequence:CCGGCTCGTAGTCAATGTGAAGAAACTCGAGTTTCTTCACATTGACTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_138959.1-861s1c1
Sequence:CCGGCTACAAAGATTTCACCATCTACTCGAGTAGATGGTGAAATCTTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138959.2-1827s21c1
Sequence:CCGGAGTCTGAGACATCCGTTTAAACTCGAGTTTAAACGGATGTCTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138959.2-724s21c1
Sequence:CCGGGCTCTTTATCTCCATGGCATTCTCGAGAATGCCATGGAGATAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_138959.2-1739s21c1
Sequence:CCGGCTCGTAGTCAATGTGAAGAAACTCGAGTTTCTTCACATTGACTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_138959.2-1763s21c1
Sequence:CCGGCCATTCATCATACTCTCTGAACTCGAGTTCAGAGAGTATGATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138959
VALIDATED
VANGL1 MISSION shRNA shRNA Plasmid DNA
VANGL planar cell polarity protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138959.1-1056s1c1
Sequence:CCGGCGAACATGAACGGCGAGTAAACTCGAGTTTACTCGCCGTTCATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138959.1-465s1c1
Sequence:CCGGGCTCTTTATCTCCATGGCATTCTCGAGAATGCCATGGAGATAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138959.1-1504s1c1
Sequence:CCGGCCATTCATCATACTCTCTGAACTCGAGTTCAGAGAGTATGATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_138959.1-1480s1c1
Sequence:CCGGCTCGTAGTCAATGTGAAGAAACTCGAGTTTCTTCACATTGACTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_138959.1-861s1c1
Sequence:CCGGCTACAAAGATTTCACCATCTACTCGAGTAGATGGTGAAATCTTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138959.2-1827s21c1
Sequence:CCGGAGTCTGAGACATCCGTTTAAACTCGAGTTTAAACGGATGTCTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138959.2-724s21c1
Sequence:CCGGGCTCTTTATCTCCATGGCATTCTCGAGAATGCCATGGAGATAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_138959.2-1739s21c1
Sequence:CCGGCTCGTAGTCAATGTGAAGAAACTCGAGTTTCTTCACATTGACTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_138959.2-1763s21c1
Sequence:CCGGCCATTCATCATACTCTCTGAACTCGAGTTCAGAGAGTATGATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138959
VALIDATED
VANGL1 MISSION shRNA Lentiviral Transduction Particles
VANGL planar cell polarity protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138959.1-1056s1c1
Sequence:CCGGCGAACATGAACGGCGAGTAAACTCGAGTTTACTCGCCGTTCATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138959.1-465s1c1
Sequence:CCGGGCTCTTTATCTCCATGGCATTCTCGAGAATGCCATGGAGATAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138959.1-1504s1c1
Sequence:CCGGCCATTCATCATACTCTCTGAACTCGAGTTCAGAGAGTATGATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_138959.1-1480s1c1
Sequence:CCGGCTCGTAGTCAATGTGAAGAAACTCGAGTTTCTTCACATTGACTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_138959.1-861s1c1
Sequence:CCGGCTACAAAGATTTCACCATCTACTCGAGTAGATGGTGAAATCTTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138959.2-1827s21c1
Sequence:CCGGAGTCTGAGACATCCGTTTAAACTCGAGTTTAAACGGATGTCTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138959.2-724s21c1
Sequence:CCGGGCTCTTTATCTCCATGGCATTCTCGAGAATGCCATGGAGATAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_138959.2-1739s21c1
Sequence:CCGGCTCGTAGTCAATGTGAAGAAACTCGAGTTTCTTCACATTGACTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_138959.2-1763s21c1
Sequence:CCGGCCATTCATCATACTCTCTGAACTCGAGTTCAGAGAGTATGATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177545
VANGL1 MISSION shRNA Bacterial Glycerol Stock
VANGL planar cell polarity protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177545.2-1661s1c1
Sequence:CCGGCGTCCTTAAATGCTTGGACTTCTCGAGAAGTCCAAGCATTTAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177545.2-460s1c1
Sequence:CCGGGCACCTCAGAGCACAGTATATCTCGAGATATACTGTGCTCTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177545.2-1230s1c1
Sequence:CCGGTCCAGCCACAACGAGTTGTATCTCGAGATACAACTCGTTGTGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177545.2-1097s1c1
Sequence:CCGGCCTCCTAACAGCATCCAAATTCTCGAGAATTTGGATGCTGTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177545.2-1528s1c1
Sequence:CCGGCCAAGGCTTTCCTTGAACGATCTCGAGATCGTTCAAGGAAAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177545
VANGL1 MISSION shRNA shRNA Plasmid DNA
VANGL planar cell polarity protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177545.2-1661s1c1
Sequence:CCGGCGTCCTTAAATGCTTGGACTTCTCGAGAAGTCCAAGCATTTAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177545.2-460s1c1
Sequence:CCGGGCACCTCAGAGCACAGTATATCTCGAGATATACTGTGCTCTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177545.2-1230s1c1
Sequence:CCGGTCCAGCCACAACGAGTTGTATCTCGAGATACAACTCGTTGTGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177545.2-1097s1c1
Sequence:CCGGCCTCCTAACAGCATCCAAATTCTCGAGAATTTGGATGCTGTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177545.2-1528s1c1
Sequence:CCGGCCAAGGCTTTCCTTGAACGATCTCGAGATCGTTCAAGGAAAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177545
VANGL1 MISSION shRNA Lentiviral Transduction Particles
VANGL planar cell polarity protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177545.2-1661s1c1
Sequence:CCGGCGTCCTTAAATGCTTGGACTTCTCGAGAAGTCCAAGCATTTAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177545.2-460s1c1
Sequence:CCGGGCACCTCAGAGCACAGTATATCTCGAGATATACTGTGCTCTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177545.2-1230s1c1
Sequence:CCGGTCCAGCCACAACGAGTTGTATCTCGAGATACAACTCGTTGTGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177545.2-1097s1c1
Sequence:CCGGCCTCCTAACAGCATCCAAATTCTCGAGAATTTGGATGCTGTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177545.2-1528s1c1
Sequence:CCGGCCAAGGCTTTCCTTGAACGATCTCGAGATCGTTCAAGGAAAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks