EMAIL THIS PAGE TO A FRIEND

VANGL2

VANGL planar cell polarity protein 2

Synonyms: LPP1 LTAP STB1 STBM STBM1
UniProtKB ID: Q9ULK5, D3DVE9, Q5T212
Gene ID:
Human(57216) Summary: The protein encoded by this gene is a membrane protein involved in the regulation of planar cell polarity, especially in the stereociliary bundles of the cochlea. The encoded protein transmits directional signals to individual cells or groups of cells in epithelial sheets. This protein is also involved in the development of the neural plate. [provided by RefSeq, Sep 2011]
Mouse(93840) vang-like 2 (van gogh, Drosophila)
Rat(289229) VANGL planar cell polarity protein 2
cow(520544) vang-like 2 (van gogh, Drosophila)
sheep(101102530) vang-like 2 (van gogh, Drosophila)
domestic guinea pig(100732368) VANGL planar cell polarity protein 2
naked mole-rat(101715508) VANGL planar cell polarity protein 2
Zebrafish(245949) vang-like 2 (van gogh, Drosophila)
chicken(426903) vang-like 2 (van gogh, Drosophila)
domestic cat(101094645) vang-like 2 (van gogh, Drosophila)
dog(610037) vang-like 2 (van gogh, Drosophila)
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020335 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033509 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033509 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033509 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010511 MISSION® esiRNA esiRNA targeting human VANGL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020335 Rosetta Predictions human pricing
NM_001105969 Rosetta Predictions rat pricing
NM_033509 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058781 predicted 1817
2 SASI_Hs01_00058782 predicted 1426
3 SASI_Hs01_00058783 predicted 1059
4 SASI_Hs01_00058784 predicted 1299
5 SASI_Hs01_00058786 predicted 1110
6 SASI_Hs01_00058789 predicted 1501
7 SASI_Hs01_00058790 predicted 691
8 SASI_Hs02_00353259 predicted 2422
9 SASI_Hs02_00353260 predicted 1442
10 SASI_Hs01_00058785 predicted 1260
11 SASI_Hs01_00058787 predicted 1328
12 SASI_Hs01_00058788 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105969 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214332 predicted 1256
2 SASI_Rn02_00214333 predicted 1047
3 SASI_Rn02_00214334 predicted 1527
4 SASI_Rn02_00214335 predicted 1415
5 SASI_Rn02_00214336 predicted 1172
6 SASI_Rn02_00214337 predicted 1998
7 SASI_Rn02_00214338 predicted 1357
8 SASI_Rn02_00214339 predicted 596
9 SASI_Rn02_00214340 predicted 1607
10 SASI_Rn02_00214341 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095674 predicted 1349
2 SASI_Mm02_00337373 predicted 1091
3 SASI_Mm02_00337374 predicted 687
4 SASI_Mm01_00095677 predicted 1907
5 SASI_Mm02_00337375 predicted 564
6 SASI_Mm02_00337376 predicted 893
7 SASI_Mm01_00095678 predicted 912
8 SASI_Mm02_00337377 predicted 1005
9 SASI_Mm01_00095679 predicted 1237
10 SASI_Mm02_00337378 predicted 1054
11 SASI_Mm01_00095675 predicted 1139
12 SASI_Mm01_00095676 predicted 1414
13 SASI_Mm01_00095680 predicted 1307
14 SASI_Mm01_00095681 predicted 1783
15 SASI_Mm01_00095682 predicted 1299
16 SASI_Mm01_00095683 predicted 1688
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020335
VALIDATED
VANGL2 MISSION shRNA Bacterial Glycerol Stock
VANGL planar cell polarity protein 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020335.1-1577s21c1
Sequence:CCGGAGGAGGCCTTCACTCACATTACTCGAGTAATGTGAGTGAAGGCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020335.1-1975s21c1
Sequence:CCGGTTCAAACTCTCCGAGGAATTTCTCGAGAAATTCCTCGGAGAGTTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020335.1-1496s21c1
Sequence:CCGGGTCACAATGAGTACTACTATGCTCGAGCATAGTAGTACTCATTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020335.1-2004s1c1
Sequence:CCGGCAAGTCACACAAGTTTGTCATCTCGAGATGACAAACTTGTGTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020335.1-1303s1c1
Sequence:CCGGGTGTGGATCCTGGAGAAGTATCTCGAGATACTTCTCCAGGATCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020335.1-930s1c1
Sequence:CCGGCTTCATCTCTGTCGCCTTCAACTCGAGTTGAAGGCGACAGAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020335.1-1999s1c1
Sequence:CCGGGATCCCAAGTCACACAAGTTTCTCGAGAAACTTGTGTGACTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020335
VALIDATED
VANGL2 MISSION shRNA shRNA Plasmid DNA
VANGL planar cell polarity protein 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020335.1-1577s21c1
Sequence:CCGGAGGAGGCCTTCACTCACATTACTCGAGTAATGTGAGTGAAGGCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020335.1-1975s21c1
Sequence:CCGGTTCAAACTCTCCGAGGAATTTCTCGAGAAATTCCTCGGAGAGTTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020335.1-1496s21c1
Sequence:CCGGGTCACAATGAGTACTACTATGCTCGAGCATAGTAGTACTCATTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020335.1-2004s1c1
Sequence:CCGGCAAGTCACACAAGTTTGTCATCTCGAGATGACAAACTTGTGTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020335.1-1303s1c1
Sequence:CCGGGTGTGGATCCTGGAGAAGTATCTCGAGATACTTCTCCAGGATCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020335.1-930s1c1
Sequence:CCGGCTTCATCTCTGTCGCCTTCAACTCGAGTTGAAGGCGACAGAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020335.1-1999s1c1
Sequence:CCGGGATCCCAAGTCACACAAGTTTCTCGAGAAACTTGTGTGACTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020335
VALIDATED
VANGL2 MISSION shRNA Lentiviral Transduction Particles
VANGL planar cell polarity protein 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020335.1-1577s21c1
Sequence:CCGGAGGAGGCCTTCACTCACATTACTCGAGTAATGTGAGTGAAGGCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020335.1-1975s21c1
Sequence:CCGGTTCAAACTCTCCGAGGAATTTCTCGAGAAATTCCTCGGAGAGTTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020335.1-1496s21c1
Sequence:CCGGGTCACAATGAGTACTACTATGCTCGAGCATAGTAGTACTCATTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020335.1-2004s1c1
Sequence:CCGGCAAGTCACACAAGTTTGTCATCTCGAGATGACAAACTTGTGTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020335.1-1303s1c1
Sequence:CCGGGTGTGGATCCTGGAGAAGTATCTCGAGATACTTCTCCAGGATCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020335.1-930s1c1
Sequence:CCGGCTTCATCTCTGTCGCCTTCAACTCGAGTTGAAGGCGACAGAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020335.1-1999s1c1
Sequence:CCGGGATCCCAAGTCACACAAGTTTCTCGAGAAACTTGTGTGACTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033509
VANGL2 MISSION shRNA Bacterial Glycerol Stock
VANGL planar cell polarity protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033509.2-2102s1c1
Sequence:CCGGGACACATTTCTGCCAGTCCTACTCGAGTAGGACTGGCAGAAATGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033509.2-1121s1c1
Sequence:CCGGGTTTCTCTAGTGGATGCTTTACTCGAGTAAAGCATCCACTAGAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033509.2-580s1c1
Sequence:CCGGTGGAGATAAATCAGTGACGATCTCGAGATCGTCACTGATTTATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033509.2-1738s1c1
Sequence:CCGGGTTCTGCATTACCCACGACATCTCGAGATGTCGTGGGTAATGCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033509.2-1120s1c1
Sequence:CCGGCGTTTCTCTAGTGGATGCTTTCTCGAGAAAGCATCCACTAGAGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033509
VANGL2 MISSION shRNA shRNA Plasmid DNA
VANGL planar cell polarity protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033509.2-2102s1c1
Sequence:CCGGGACACATTTCTGCCAGTCCTACTCGAGTAGGACTGGCAGAAATGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033509.2-1121s1c1
Sequence:CCGGGTTTCTCTAGTGGATGCTTTACTCGAGTAAAGCATCCACTAGAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033509.2-580s1c1
Sequence:CCGGTGGAGATAAATCAGTGACGATCTCGAGATCGTCACTGATTTATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033509.2-1738s1c1
Sequence:CCGGGTTCTGCATTACCCACGACATCTCGAGATGTCGTGGGTAATGCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033509.2-1120s1c1
Sequence:CCGGCGTTTCTCTAGTGGATGCTTTCTCGAGAAAGCATCCACTAGAGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033509
VANGL2 MISSION shRNA Lentiviral Transduction Particles
VANGL planar cell polarity protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033509.2-2102s1c1
Sequence:CCGGGACACATTTCTGCCAGTCCTACTCGAGTAGGACTGGCAGAAATGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033509.2-1121s1c1
Sequence:CCGGGTTTCTCTAGTGGATGCTTTACTCGAGTAAAGCATCCACTAGAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033509.2-580s1c1
Sequence:CCGGTGGAGATAAATCAGTGACGATCTCGAGATCGTCACTGATTTATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033509.2-1738s1c1
Sequence:CCGGGTTCTGCATTACCCACGACATCTCGAGATGTCGTGGGTAATGCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033509.2-1120s1c1
Sequence:CCGGCGTTTCTCTAGTGGATGCTTTCTCGAGAAAGCATCCACTAGAGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks