EMAIL THIS PAGE TO A FRIEND

VAPA

VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa

Synonyms: VAP-33 VAP-A VAP33 hVAP-33
UniProtKB ID: Q9P0L0, A6NDZ0, D3DUI3, O75453, Q5U0E7, Q9UBZ2
Gene ID:
Human(9218) Summary: The protein encoded by this gene is a type IV membrane protein. It is present in the plasma membrane and intracellular vesicles. It may also be associated with the cytoskeleton. This protein may function in vesicle trafficking, membrane fusion, protein complex assembly and cell motility. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(30960) vesicle-associated membrane protein, associated protein A
Rat(58857) VAMP (vesicle-associated membrane protein)-associated protein A
Zebrafish(334608) VAMP (vesicle-associated membrane protein)-associated protein A
domestic cat(101100344) VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa
dog(480208) VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa
chicken(768928) VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa
naked mole-rat(101713962) VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa
domestic guinea pig(100735161) VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa
cow(516024) VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa
sheep(101104707) VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa
147 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1773 Human VAP-A ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013933 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013933 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013933 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003574 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003574 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003574 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003574 Rosetta Predictions human pricing
NM_194434 Rosetta Predictions human pricing
NM_031631 Rosetta Predictions rat pricing
NM_013933 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028868 predicted 784
2 SASI_Hs01_00028869 predicted 712
3 SASI_Hs01_00028870 predicted 786
4 SASI_Hs01_00028871 predicted 577
5 SASI_Hs01_00028872 predicted 887
6 SASI_Hs01_00028873 predicted 951
7 SASI_Hs01_00028874 predicted 861
8 SASI_Hs01_00028875 predicted 767
9 SASI_Hs01_00028876 predicted 887
10 SASI_Hs01_00028877 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132048 predicted 573
2 SASI_Hs01_00132049 predicted 756
3 SASI_Hs01_00132050 predicted 811
4 SASI_Hs01_00132051 predicted 721
5 SASI_Hs01_00132052 predicted 754
6 SASI_Hs01_00132053 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062103 predicted 587
2 SASI_Rn01_00062104 predicted 420
3 SASI_Rn02_00264936 predicted 758
4 SASI_Rn01_00062106 predicted 479
5 SASI_Rn01_00062107 predicted 832
6 SASI_Rn01_00062108 predicted 646
7 SASI_Rn01_00062109 predicted 599
8 SASI_Rn02_00264937 predicted 507
9 SASI_Rn01_00062111 predicted 843
10 SASI_Rn01_00062112 predicted 468
11 SASI_Rn01_00062105 predicted 441
12 SASI_Rn01_00062110 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021239 predicted 594
2 SASI_Mm01_00021240 predicted 592
3 SASI_Mm01_00021241 predicted 485
4 SASI_Mm01_00021242 predicted 681
5 SASI_Mm01_00021243 predicted 730
6 SASI_Mm01_00021244 predicted 665
7 SASI_Mm01_00021245 predicted 425
8 SASI_Mm01_00021246 predicted 771
9 SASI_Mm01_00021247 predicted 626
10 SASI_Mm01_00021248 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013933
VALIDATED
VAPA MISSION shRNA Bacterial Glycerol Stock
VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013933.2-1498s1c1
Sequence:CCGGGCTAATATCATGGCAGAATTTCTCGAGAAATTCTGCCATGATATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013933.2-727s1c1
Sequence:CCGGCCACACAGTGTTTCACTCAATCTCGAGATTGAGTGAAACACTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013933.2-331s1c1
Sequence:CCGGACAGATGTAGTCACTACAAATCTCGAGATTTGTAGTGACTACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013933.2-892s1c1
Sequence:CCGGGCCGTGTCCTTCAGAGATAATCTCGAGATTATCTCTGAAGGACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013933.2-487s1c1
Sequence:CCGGCCCTTTGATTATGATCCGAATCTCGAGATTCGGATCATAATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013933.2-780s21c1
Sequence:CCGGCAAGCGACTCCAGGGAGAAATCTCGAGATTTCTCCCTGGAGTCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013933.2-331s21c1
Sequence:CCGGACAGATGTAGTCACTACAAATCTCGAGATTTGTAGTGACTACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013933.2-892s21c1
Sequence:CCGGGCCGTGTCCTTCAGAGATAATCTCGAGATTATCTCTGAAGGACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013933.2-1248s21c1
Sequence:CCGGGTTGCACATTCAGTCCTTTATCTCGAGATAAAGGACTGAATGTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013933.2-297s21c1
Sequence:GTACCGGCCCTCCTTCAGACCTCAAATTCTCGAGAATTTGAGGTCTGAAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013933.2-1122s21c1
Sequence:GTACCGGTTTGTGTGTACAGCGTCATATCTCGAGATATGACGCTGTACACACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013933.2-1052s21c1
Sequence:GTACCGGAGATTTGTTTACCTACCATTTCTCGAGAAATGGTAGGTAAACAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013933
VALIDATED
VAPA MISSION shRNA shRNA Plasmid DNA
VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013933.2-1498s1c1
Sequence:CCGGGCTAATATCATGGCAGAATTTCTCGAGAAATTCTGCCATGATATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013933.2-727s1c1
Sequence:CCGGCCACACAGTGTTTCACTCAATCTCGAGATTGAGTGAAACACTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013933.2-331s1c1
Sequence:CCGGACAGATGTAGTCACTACAAATCTCGAGATTTGTAGTGACTACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013933.2-892s1c1
Sequence:CCGGGCCGTGTCCTTCAGAGATAATCTCGAGATTATCTCTGAAGGACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013933.2-487s1c1
Sequence:CCGGCCCTTTGATTATGATCCGAATCTCGAGATTCGGATCATAATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013933.2-780s21c1
Sequence:CCGGCAAGCGACTCCAGGGAGAAATCTCGAGATTTCTCCCTGGAGTCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013933.2-331s21c1
Sequence:CCGGACAGATGTAGTCACTACAAATCTCGAGATTTGTAGTGACTACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013933.2-892s21c1
Sequence:CCGGGCCGTGTCCTTCAGAGATAATCTCGAGATTATCTCTGAAGGACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013933.2-1248s21c1
Sequence:CCGGGTTGCACATTCAGTCCTTTATCTCGAGATAAAGGACTGAATGTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013933.2-297s21c1
Sequence:GTACCGGCCCTCCTTCAGACCTCAAATTCTCGAGAATTTGAGGTCTGAAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013933.2-1122s21c1
Sequence:GTACCGGTTTGTGTGTACAGCGTCATATCTCGAGATATGACGCTGTACACACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013933.2-1052s21c1
Sequence:GTACCGGAGATTTGTTTACCTACCATTTCTCGAGAAATGGTAGGTAAACAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013933
VALIDATED
VAPA MISSION shRNA Lentiviral Transduction Particles
VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013933.2-1498s1c1
Sequence:CCGGGCTAATATCATGGCAGAATTTCTCGAGAAATTCTGCCATGATATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013933.2-727s1c1
Sequence:CCGGCCACACAGTGTTTCACTCAATCTCGAGATTGAGTGAAACACTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013933.2-331s1c1
Sequence:CCGGACAGATGTAGTCACTACAAATCTCGAGATTTGTAGTGACTACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013933.2-892s1c1
Sequence:CCGGGCCGTGTCCTTCAGAGATAATCTCGAGATTATCTCTGAAGGACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013933.2-487s1c1
Sequence:CCGGCCCTTTGATTATGATCCGAATCTCGAGATTCGGATCATAATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013933.2-780s21c1
Sequence:CCGGCAAGCGACTCCAGGGAGAAATCTCGAGATTTCTCCCTGGAGTCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013933.2-331s21c1
Sequence:CCGGACAGATGTAGTCACTACAAATCTCGAGATTTGTAGTGACTACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013933.2-892s21c1
Sequence:CCGGGCCGTGTCCTTCAGAGATAATCTCGAGATTATCTCTGAAGGACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013933.2-1248s21c1
Sequence:CCGGGTTGCACATTCAGTCCTTTATCTCGAGATAAAGGACTGAATGTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013933.2-297s21c1
Sequence:GTACCGGCCCTCCTTCAGACCTCAAATTCTCGAGAATTTGAGGTCTGAAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013933.2-1122s21c1
Sequence:GTACCGGTTTGTGTGTACAGCGTCATATCTCGAGATATGACGCTGTACACACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013933.2-1052s21c1
Sequence:GTACCGGAGATTTGTTTACCTACCATTTCTCGAGAAATGGTAGGTAAACAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003574
VALIDATED
VAPA MISSION shRNA Bacterial Glycerol Stock
VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003574.4-387s1c1
Sequence:CCGGGCGAAATCCATCGGATAGAAACTCGAGTTTCTATCCGATGGATTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003574.4-513s1c1
Sequence:CCGGGCCCTTTGACTATGATCCGAACTCGAGTTCGGATCATAGTCAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003574.4-1099s1c1
Sequence:CCGGCTTGTTGTAATTGCAGCCATTCTCGAGAATGGCTGCAATTACAACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003574.4-760s1c1
Sequence:CCGGGCCAGTTATCACACGAAGGATCTCGAGATCCTTCGTGTGATAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003574.4-902s1c1
Sequence:CCGGCACTTAATGATACCGAAACAACTCGAGTTGTTTCGGTATCATTAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003574.5-778s21c1
Sequence:GTACCGGTTGCAACACCTGCCAGTTATCCTCGAGGATAACTGGCAGGTGTTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003574.5-580s21c1
Sequence:GTACCGGAGTTTATGGTACAGACAATTTCTCGAGAAATTGTCTGTACCATAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-352s21c1
Sequence:CCGGATCCGCCCACAGACCTCAAATCTCGAGATTTGAGGTCTGTGGGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-669s21c1
Sequence:CCGGTCCAAATTGAGATGCGTATTTCTCGAGAAATACGCATCTCAATTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-1290s21c1
Sequence:CCGGTTTGTGTGTACAGCGTCATATCTCGAGATATGACGCTGTACACACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-416s21c1
Sequence:CCGGGCGAAATCCATCGGATAGAAACTCGAGTTTCTATCCGATGGATTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003574.5-738s21c1
Sequence:CCGGGCTCCGACTGTCACTTCAATGCTCGAGCATTGAAGTGACAGTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-942s21c1
Sequence:GTACCGGACCGAAACAAGGAAACTAATGCTCGAGCATTAGTTTCCTTGTTTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003574.5-1669s21c1
Sequence:GTACCGGGCTAATATCATGGCAGAATTTCTCGAGAAATTCTGCCATGATATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-917s21c1
Sequence:GTACCGGACCACACAGTGTTTCACTTAACTCGAGTTAAGTGAAACACTGTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003574
VALIDATED
VAPA MISSION shRNA shRNA Plasmid DNA
VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003574.4-387s1c1
Sequence:CCGGGCGAAATCCATCGGATAGAAACTCGAGTTTCTATCCGATGGATTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003574.4-513s1c1
Sequence:CCGGGCCCTTTGACTATGATCCGAACTCGAGTTCGGATCATAGTCAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003574.4-1099s1c1
Sequence:CCGGCTTGTTGTAATTGCAGCCATTCTCGAGAATGGCTGCAATTACAACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003574.4-760s1c1
Sequence:CCGGGCCAGTTATCACACGAAGGATCTCGAGATCCTTCGTGTGATAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003574.4-902s1c1
Sequence:CCGGCACTTAATGATACCGAAACAACTCGAGTTGTTTCGGTATCATTAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003574.5-778s21c1
Sequence:GTACCGGTTGCAACACCTGCCAGTTATCCTCGAGGATAACTGGCAGGTGTTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003574.5-580s21c1
Sequence:GTACCGGAGTTTATGGTACAGACAATTTCTCGAGAAATTGTCTGTACCATAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-352s21c1
Sequence:CCGGATCCGCCCACAGACCTCAAATCTCGAGATTTGAGGTCTGTGGGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-669s21c1
Sequence:CCGGTCCAAATTGAGATGCGTATTTCTCGAGAAATACGCATCTCAATTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-1290s21c1
Sequence:CCGGTTTGTGTGTACAGCGTCATATCTCGAGATATGACGCTGTACACACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-416s21c1
Sequence:CCGGGCGAAATCCATCGGATAGAAACTCGAGTTTCTATCCGATGGATTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003574.5-738s21c1
Sequence:CCGGGCTCCGACTGTCACTTCAATGCTCGAGCATTGAAGTGACAGTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-942s21c1
Sequence:GTACCGGACCGAAACAAGGAAACTAATGCTCGAGCATTAGTTTCCTTGTTTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003574.5-1669s21c1
Sequence:GTACCGGGCTAATATCATGGCAGAATTTCTCGAGAAATTCTGCCATGATATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-917s21c1
Sequence:GTACCGGACCACACAGTGTTTCACTTAACTCGAGTTAAGTGAAACACTGTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003574
VALIDATED
VAPA MISSION shRNA Lentiviral Transduction Particles
VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003574.4-387s1c1
Sequence:CCGGGCGAAATCCATCGGATAGAAACTCGAGTTTCTATCCGATGGATTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003574.4-513s1c1
Sequence:CCGGGCCCTTTGACTATGATCCGAACTCGAGTTCGGATCATAGTCAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003574.4-1099s1c1
Sequence:CCGGCTTGTTGTAATTGCAGCCATTCTCGAGAATGGCTGCAATTACAACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003574.4-760s1c1
Sequence:CCGGGCCAGTTATCACACGAAGGATCTCGAGATCCTTCGTGTGATAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003574.4-902s1c1
Sequence:CCGGCACTTAATGATACCGAAACAACTCGAGTTGTTTCGGTATCATTAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003574.5-778s21c1
Sequence:GTACCGGTTGCAACACCTGCCAGTTATCCTCGAGGATAACTGGCAGGTGTTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003574.5-580s21c1
Sequence:GTACCGGAGTTTATGGTACAGACAATTTCTCGAGAAATTGTCTGTACCATAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-352s21c1
Sequence:CCGGATCCGCCCACAGACCTCAAATCTCGAGATTTGAGGTCTGTGGGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-669s21c1
Sequence:CCGGTCCAAATTGAGATGCGTATTTCTCGAGAAATACGCATCTCAATTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-1290s21c1
Sequence:CCGGTTTGTGTGTACAGCGTCATATCTCGAGATATGACGCTGTACACACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-416s21c1
Sequence:CCGGGCGAAATCCATCGGATAGAAACTCGAGTTTCTATCCGATGGATTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003574.5-738s21c1
Sequence:CCGGGCTCCGACTGTCACTTCAATGCTCGAGCATTGAAGTGACAGTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-942s21c1
Sequence:GTACCGGACCGAAACAAGGAAACTAATGCTCGAGCATTAGTTTCCTTGTTTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003574.5-1669s21c1
Sequence:GTACCGGGCTAATATCATGGCAGAATTTCTCGAGAAATTCTGCCATGATATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003574.5-917s21c1
Sequence:GTACCGGACCACACAGTGTTTCACTTAACTCGAGTTAAGTGAAACACTGTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks