EMAIL THIS PAGE TO A FRIEND

VAPB

VAMP (vesicle-associated membrane protein)-associated protein B and C

Synonyms: ALS8 VAMP-B VAP-B
UniProtKB ID: O95292, A2A2F2, O95293, Q9P0H0
Gene ID:
Human(9217) Summary: The protein encoded by this gene is a type IV membrane protein found in plasma and intracellular vesicle membranes. The encoded protein is found as a homodimer and as a heterodimer with VAPA. This protein also can interact with VAMP1 and VAMP2 and may be involved in vesicle trafficking. [provided by RefSeq, Jul 2008]
Mouse(56491) vesicle-associated membrane protein, associated protein B and C
Rat(60431) VAMP (vesicle-associated membrane protein)-associated protein B and C
Zebrafish(323628) vesicle-associated membrane protein, associated protein B and C
chicken(419317) VAMP (vesicle-associated membrane protein)-associated protein B and C
dog(477274) VAMP (vesicle-associated membrane protein)-associated protein B and C
domestic cat(101092172) VAMP (vesicle-associated membrane protein)-associated protein B and C
cow(326580) VAMP (vesicle-associated membrane protein)-associated protein B and C
sheep(101103170) VAMP (vesicle-associated membrane protein)-associated protein B and C
domestic guinea pig(100736066) VAMP (vesicle-associated membrane protein)-associated protein B and C
naked mole-rat(101711978) VAMP (vesicle-associated membrane protein)-associated protein B and C
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1774 Human VAP-B ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004738 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004738 Rosetta Predictions human pricing
NM_021847 Rosetta Predictions rat pricing
NM_019806 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190177 predicted 787
2 SASI_Hs01_00190178 predicted 644
3 SASI_Hs01_00190179 predicted 725
4 SASI_Hs01_00190180 predicted 490
5 SASI_Hs01_00190181 predicted 554
6 SASI_Hs01_00190182 predicted 1457
7 SASI_Hs01_00190183 predicted 489
8 SASI_Hs01_00190184 predicted 753
9 SASI_Hs01_00190185 predicted 724
10 SASI_Hs01_00190186 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054553 predicted 257
2 SASI_Rn02_00262866 predicted 254
3 SASI_Rn01_00054555 predicted 377
4 SASI_Rn01_00054556 predicted 200
5 SASI_Rn02_00262867 predicted 413
6 SASI_Rn02_00262868 predicted 330
7 SASI_Rn01_00054557 predicted 420
8 SASI_Rn02_00262869 predicted 282
9 SASI_Rn02_00262870 predicted 288
10 SASI_Rn01_00054560 predicted 209
11 SASI_Rn01_00054551 predicted 967
12 SASI_Rn01_00054552 predicted 1200
13 SASI_Rn01_00054554 predicted 1106
14 SASI_Rn01_00054558 predicted 1239
15 SASI_Rn01_00054559 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025608 predicted 376
2 SASI_Mm01_00025609 predicted 347
3 SASI_Mm01_00025610 predicted 812
4 SASI_Mm01_00025611 predicted 337
5 SASI_Mm01_00025612 predicted 1159
6 SASI_Mm01_00025613 predicted 337
7 SASI_Mm01_00025614 predicted 1161
8 SASI_Mm01_00025615 predicted 387
9 SASI_Mm01_00025616 predicted 1101
10 SASI_Mm01_00025617 predicted 333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004738
VALIDATED
VAPB MISSION shRNA Bacterial Glycerol Stock
VAMP (vesicle-associated membrane protein)-associated protein B and C
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004738.3-485s21c1
Sequence:GTACCGGATGTTACAGCCTTTCGATTATCTCGAGATAATCGAAAGGCTGTAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004738.3-343s21c1
Sequence:GTACCGGTGTTGTCACCACCAACCTAAACTCGAGTTTAGGTTGGTGGTGACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004738.3-603s21c1
Sequence:CCGGCGGAAGACCTTATGGATTCAACTCGAGTTGAATCCATAAGGTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004738.3-2256s21c1
Sequence:CCGGCCAGTTCTGTTTGACTATGTACTCGAGTACATAGTCAAACAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004738.3-376s21c1
Sequence:CCGGGACAGACCGAAATGTGTGTTTCTCGAGAAACACACATTTCGGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004738.3-650s21c1
Sequence:CCGGGCAGAGAATGATAAACCACATCTCGAGATGTGGTTTATCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004738.3-716s21c1
Sequence:GTACCGGGAAACACCAATAGTGTCTAAGCTCGAGCTTAGACACTATTGGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004738.3-1313s1c1
Sequence:CCGGCCTTGGTACATGATGCTGGATCTCGAGATCCAGCATCATGTACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004738.3-499s1c1
Sequence:CCGGCGATTATGATCCCAATGAGAACTCGAGTTCTCATTGGGATCATAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004738.3-650s1c1
Sequence:CCGGGCAGAGAATGATAAACCACATCTCGAGATGTGGTTTATCATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004738.3-2256s1c1
Sequence:CCGGCCAGTTCTGTTTGACTATGTACTCGAGTACATAGTCAAACAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004738.3-763s1c1
Sequence:CCGGCGAAGTTAAGAAGGTTATGGACTCGAGTCCATAACCTTCTTAACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004738.3-376s1c1
Sequence:CCGGGACAGACCGAAATGTGTGTTTCTCGAGAAACACACATTTCGGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004738.3-493s1c1
Sequence:CCGGGCCTTTCGATTATGATCCCAACTCGAGTTGGGATCATAATCGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004738.3-782s1c1
Sequence:CCGGGAAGAATGTAAGAGGCTGCAACTCGAGTTGCAGCCTCTTACATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004738.3-827s1c1
Sequence:CCGGGAGAACAAGCAGTTCAAGGAACTCGAGTTCCTTGAACTGCTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004738.3-603s1c1
Sequence:CCGGCGGAAGACCTTATGGATTCAACTCGAGTTGAATCCATAAGGTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004738
VALIDATED
VAPB MISSION shRNA shRNA Plasmid DNA
VAMP (vesicle-associated membrane protein)-associated protein B and C
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004738.3-485s21c1
Sequence:GTACCGGATGTTACAGCCTTTCGATTATCTCGAGATAATCGAAAGGCTGTAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004738.3-343s21c1
Sequence:GTACCGGTGTTGTCACCACCAACCTAAACTCGAGTTTAGGTTGGTGGTGACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004738.3-603s21c1
Sequence:CCGGCGGAAGACCTTATGGATTCAACTCGAGTTGAATCCATAAGGTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004738.3-2256s21c1
Sequence:CCGGCCAGTTCTGTTTGACTATGTACTCGAGTACATAGTCAAACAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004738.3-376s21c1
Sequence:CCGGGACAGACCGAAATGTGTGTTTCTCGAGAAACACACATTTCGGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004738.3-650s21c1
Sequence:CCGGGCAGAGAATGATAAACCACATCTCGAGATGTGGTTTATCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004738.3-716s21c1
Sequence:GTACCGGGAAACACCAATAGTGTCTAAGCTCGAGCTTAGACACTATTGGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004738.3-1313s1c1
Sequence:CCGGCCTTGGTACATGATGCTGGATCTCGAGATCCAGCATCATGTACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004738.3-499s1c1
Sequence:CCGGCGATTATGATCCCAATGAGAACTCGAGTTCTCATTGGGATCATAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004738.3-650s1c1
Sequence:CCGGGCAGAGAATGATAAACCACATCTCGAGATGTGGTTTATCATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004738.3-2256s1c1
Sequence:CCGGCCAGTTCTGTTTGACTATGTACTCGAGTACATAGTCAAACAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004738.3-763s1c1
Sequence:CCGGCGAAGTTAAGAAGGTTATGGACTCGAGTCCATAACCTTCTTAACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004738.3-376s1c1
Sequence:CCGGGACAGACCGAAATGTGTGTTTCTCGAGAAACACACATTTCGGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004738.3-493s1c1
Sequence:CCGGGCCTTTCGATTATGATCCCAACTCGAGTTGGGATCATAATCGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004738.3-782s1c1
Sequence:CCGGGAAGAATGTAAGAGGCTGCAACTCGAGTTGCAGCCTCTTACATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004738.3-827s1c1
Sequence:CCGGGAGAACAAGCAGTTCAAGGAACTCGAGTTCCTTGAACTGCTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004738.3-603s1c1
Sequence:CCGGCGGAAGACCTTATGGATTCAACTCGAGTTGAATCCATAAGGTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004738
VALIDATED
VAPB MISSION shRNA Lentiviral Transduction Particles
VAMP (vesicle-associated membrane protein)-associated protein B and C
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004738.3-485s21c1
Sequence:GTACCGGATGTTACAGCCTTTCGATTATCTCGAGATAATCGAAAGGCTGTAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004738.3-343s21c1
Sequence:GTACCGGTGTTGTCACCACCAACCTAAACTCGAGTTTAGGTTGGTGGTGACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004738.3-603s21c1
Sequence:CCGGCGGAAGACCTTATGGATTCAACTCGAGTTGAATCCATAAGGTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004738.3-2256s21c1
Sequence:CCGGCCAGTTCTGTTTGACTATGTACTCGAGTACATAGTCAAACAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004738.3-376s21c1
Sequence:CCGGGACAGACCGAAATGTGTGTTTCTCGAGAAACACACATTTCGGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004738.3-650s21c1
Sequence:CCGGGCAGAGAATGATAAACCACATCTCGAGATGTGGTTTATCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004738.3-716s21c1
Sequence:GTACCGGGAAACACCAATAGTGTCTAAGCTCGAGCTTAGACACTATTGGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004738.3-1313s1c1
Sequence:CCGGCCTTGGTACATGATGCTGGATCTCGAGATCCAGCATCATGTACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004738.3-499s1c1
Sequence:CCGGCGATTATGATCCCAATGAGAACTCGAGTTCTCATTGGGATCATAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004738.3-650s1c1
Sequence:CCGGGCAGAGAATGATAAACCACATCTCGAGATGTGGTTTATCATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004738.3-2256s1c1
Sequence:CCGGCCAGTTCTGTTTGACTATGTACTCGAGTACATAGTCAAACAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004738.3-763s1c1
Sequence:CCGGCGAAGTTAAGAAGGTTATGGACTCGAGTCCATAACCTTCTTAACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004738.3-376s1c1
Sequence:CCGGGACAGACCGAAATGTGTGTTTCTCGAGAAACACACATTTCGGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004738.3-493s1c1
Sequence:CCGGGCCTTTCGATTATGATCCCAACTCGAGTTGGGATCATAATCGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004738.3-782s1c1
Sequence:CCGGGAAGAATGTAAGAGGCTGCAACTCGAGTTGCAGCCTCTTACATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004738.3-827s1c1
Sequence:CCGGGAGAACAAGCAGTTCAAGGAACTCGAGTTCCTTGAACTGCTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004738.3-603s1c1
Sequence:CCGGCGGAAGACCTTATGGATTCAACTCGAGTTGAATCCATAAGGTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019806
VALIDATED
VAPB MISSION shRNA Bacterial Glycerol Stock
VAMP (vesicle-associated membrane protein)-associated protein B and C
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019806.5-219s21c1
Sequence:CCGGGGCAACCCAACAGACCGAAATCTCGAGATTTCGGTCTGTTGGGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019806.3-345s1c1
Sequence:CCGGCCTTTCGATTATGATCCCAATCTCGAGATTGGGATCATAATCGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019806.3-454s1c1
Sequence:CCGGCGGAAGACCTTATGGATTCAACTCGAGTTGAATCCATAAGGTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019806.3-602s1c1
Sequence:CCGGCCTCGATGACACAGAAGTAAACTCGAGTTTACTTCTGTGTCATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019806.3-821s1c1
Sequence:CCGGCGTTGGTGTCATTATAGGGAACTCGAGTTCCCTATAATGACACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019806.3-1005s1c1
Sequence:CCGGGCACACACAAATATAGCATAACTCGAGTTATGCTATATTTGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019806
VALIDATED
VAPB MISSION shRNA shRNA Plasmid DNA
VAMP (vesicle-associated membrane protein)-associated protein B and C
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019806.5-219s21c1
Sequence:CCGGGGCAACCCAACAGACCGAAATCTCGAGATTTCGGTCTGTTGGGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019806.3-345s1c1
Sequence:CCGGCCTTTCGATTATGATCCCAATCTCGAGATTGGGATCATAATCGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019806.3-454s1c1
Sequence:CCGGCGGAAGACCTTATGGATTCAACTCGAGTTGAATCCATAAGGTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019806.3-602s1c1
Sequence:CCGGCCTCGATGACACAGAAGTAAACTCGAGTTTACTTCTGTGTCATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019806.3-821s1c1
Sequence:CCGGCGTTGGTGTCATTATAGGGAACTCGAGTTCCCTATAATGACACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019806.3-1005s1c1
Sequence:CCGGGCACACACAAATATAGCATAACTCGAGTTATGCTATATTTGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019806
VALIDATED
VAPB MISSION shRNA Lentiviral Transduction Particles
VAMP (vesicle-associated membrane protein)-associated protein B and C
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019806.5-219s21c1
Sequence:CCGGGGCAACCCAACAGACCGAAATCTCGAGATTTCGGTCTGTTGGGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019806.3-345s1c1
Sequence:CCGGCCTTTCGATTATGATCCCAATCTCGAGATTGGGATCATAATCGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019806.3-454s1c1
Sequence:CCGGCGGAAGACCTTATGGATTCAACTCGAGTTGAATCCATAAGGTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019806.3-602s1c1
Sequence:CCGGCCTCGATGACACAGAAGTAAACTCGAGTTTACTTCTGTGTCATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019806.3-821s1c1
Sequence:CCGGCGTTGGTGTCATTATAGGGAACTCGAGTTCCCTATAATGACACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019806.3-1005s1c1
Sequence:CCGGGCACACACAAATATAGCATAACTCGAGTTATGCTATATTTGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks