EMAIL THIS PAGE TO A FRIEND

VARS2

valyl-tRNA synthetase 2, mitochondrial

Synonyms: G7a VARS2L VARSL
Gene ID:
Mouse(68915) valyl-tRNA synthetase 2, mitochondrial (putative)
Rat(309596) valyl-tRNA synthetase 2, mitochondrial
Zebrafish(100170827) valyl-tRNA synthetase 2, mitochondrial (putative)
dog(474833) valyl-tRNA synthetase 2, mitochondrial (putative)
domestic cat(101100208) valyl-tRNA synthetase 2, mitochondrial
cow(100847824) valyl-tRNA synthetase 2, mitochondrial (putative)
sheep(101106890) valyl-tRNA synthetase 2, mitochondrial
domestic guinea pig(100735847) valyl-tRNA synthetase 2, mitochondrial
naked mole-rat(101726746) valyl-tRNA synthetase 2, mitochondrial
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020442 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175137 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175137 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175137 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020442 Rosetta Predictions human pricing
NM_213563 Rosetta Predictions rat pricing
NM_175137 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082898 predicted 1452
2 SASI_Hs01_00082899 predicted 2882
3 SASI_Hs02_00353466 predicted 863
4 SASI_Hs01_00082901 predicted 3631
5 SASI_Hs01_00082902 predicted 2071
6 SASI_Hs01_00082903 predicted 2715
7 SASI_Hs01_00082904 predicted 1242
8 SASI_Hs01_00082905 predicted 1948
9 SASI_Hs01_00082906 predicted 1467
10 SASI_Hs01_00082907 predicted 2777
11 SASI_Hs01_00082900 predicted 2859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043060 predicted 1133
2 SASI_Rn01_00043061 predicted 817
3 SASI_Rn02_00270591 predicted 1720
4 SASI_Rn01_00043063 predicted 1064
5 SASI_Rn01_00043064 predicted 2717
6 SASI_Rn01_00043065 predicted 2527
7 SASI_Rn01_00043066 predicted 2983
8 SASI_Rn01_00043067 predicted 491
9 SASI_Rn01_00043068 predicted 3103
10 SASI_Rn01_00043069 predicted 652
11 SASI_Rn01_00043062 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132450 predicted 1612
2 SASI_Mm01_00132453 predicted 3363
3 SASI_Mm01_00132454 predicted 1105
4 SASI_Mm01_00132449 predicted 926
5 SASI_Mm01_00132455 predicted 526
6 SASI_Mm02_00345772 predicted 1522
7 SASI_Mm02_00345773 predicted 684
8 SASI_Mm01_00132457 predicted 1145
9 SASI_Mm01_00132458 predicted 2563
10 SASI_Mm01_00132456 predicted 1386
11 SASI_Mm01_00132451 predicted 1089
12 SASI_Mm01_00132452 predicted 3253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020442
VALIDATED
VARS2 MISSION shRNA Bacterial Glycerol Stock
valyl-tRNA synthetase 2, mitochondrial
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020442.3-985s21c1
Sequence:CCGGTACGAGAGGGCTTCTTCAAACCTCGAGGTTTGAAGAAGCCCTCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020442.3-833s21c1
Sequence:CCGGGTCACCTGCAGAATCCATTAACTCGAGTTAATGGATTCTGCAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020442.3-3610s21c1
Sequence:CCGGAGATCCAGCTACCTCTGTTAGCTCGAGCTAACAGAGGTAGCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020442.3-3909s1c1
Sequence:CCGGGTCAGAGACTATGTGGTCCATCTCGAGATGGACCACATAGTCTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020442.3-3857s21c1
Sequence:CCGGGACCTGTCTTTGAGGACAAACCTCGAGGTTTGTCCTCAAAGACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020442.3-1462s21c1
Sequence:CCGGTCAACTGGTCATGTGCTTTAACTCGAGTTAAAGCACATGACCAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020442.3-3635s1c1
Sequence:CCGGCCGAAGGTACAAGTTGCAGAACTCGAGTTCTGCAACTTGTACCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_020442.3-2886s1c1
Sequence:CCGGGCTCTTCGCTTTATCCTCAATCTCGAGATTGAGGATAAAGCGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_020442.3-864s1c1
Sequence:CCGGCCTAAGGAGTTAGTATTGTATCTCGAGATACAATACTAACTCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020442.3-2373s1c1
Sequence:CCGGGATGTCCTAGACACATGGTTTCTCGAGAAACCATGTGTCTAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203526    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020442.3-3862s1c1
Sequence:CCGGGTCTTTGAGGACAAACAGATTCTCGAGAATCTGTTTGTCCTCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020442.3-1174s1c1
Sequence:CCGGCTGGTTCAGATCATGCAGGAACTCGAGTTCCTGCATGATCTGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020442.3-1692s1c1
Sequence:CCGGGACTCGCGATACACACATCTACTCGAGTAGATGTGTGTATCGCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020442
VALIDATED
VARS2 MISSION shRNA shRNA Plasmid DNA
valyl-tRNA synthetase 2, mitochondrial
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020442.3-985s21c1
Sequence:CCGGTACGAGAGGGCTTCTTCAAACCTCGAGGTTTGAAGAAGCCCTCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020442.3-833s21c1
Sequence:CCGGGTCACCTGCAGAATCCATTAACTCGAGTTAATGGATTCTGCAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020442.3-3610s21c1
Sequence:CCGGAGATCCAGCTACCTCTGTTAGCTCGAGCTAACAGAGGTAGCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020442.3-3909s1c1
Sequence:CCGGGTCAGAGACTATGTGGTCCATCTCGAGATGGACCACATAGTCTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020442.3-3857s21c1
Sequence:CCGGGACCTGTCTTTGAGGACAAACCTCGAGGTTTGTCCTCAAAGACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020442.3-1462s21c1
Sequence:CCGGTCAACTGGTCATGTGCTTTAACTCGAGTTAAAGCACATGACCAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020442.3-3635s1c1
Sequence:CCGGCCGAAGGTACAAGTTGCAGAACTCGAGTTCTGCAACTTGTACCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_020442.3-2886s1c1
Sequence:CCGGGCTCTTCGCTTTATCCTCAATCTCGAGATTGAGGATAAAGCGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_020442.3-864s1c1
Sequence:CCGGCCTAAGGAGTTAGTATTGTATCTCGAGATACAATACTAACTCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020442.3-2373s1c1
Sequence:CCGGGATGTCCTAGACACATGGTTTCTCGAGAAACCATGTGTCTAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203526    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020442.3-3862s1c1
Sequence:CCGGGTCTTTGAGGACAAACAGATTCTCGAGAATCTGTTTGTCCTCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020442.3-1174s1c1
Sequence:CCGGCTGGTTCAGATCATGCAGGAACTCGAGTTCCTGCATGATCTGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020442.3-1692s1c1
Sequence:CCGGGACTCGCGATACACACATCTACTCGAGTAGATGTGTGTATCGCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020442
VALIDATED
VARS2 MISSION shRNA Lentiviral Transduction Particles
valyl-tRNA synthetase 2, mitochondrial
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020442.3-985s21c1
Sequence:CCGGTACGAGAGGGCTTCTTCAAACCTCGAGGTTTGAAGAAGCCCTCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020442.3-833s21c1
Sequence:CCGGGTCACCTGCAGAATCCATTAACTCGAGTTAATGGATTCTGCAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020442.3-3610s21c1
Sequence:CCGGAGATCCAGCTACCTCTGTTAGCTCGAGCTAACAGAGGTAGCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020442.3-3909s1c1
Sequence:CCGGGTCAGAGACTATGTGGTCCATCTCGAGATGGACCACATAGTCTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020442.3-3857s21c1
Sequence:CCGGGACCTGTCTTTGAGGACAAACCTCGAGGTTTGTCCTCAAAGACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020442.3-1462s21c1
Sequence:CCGGTCAACTGGTCATGTGCTTTAACTCGAGTTAAAGCACATGACCAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020442.3-3635s1c1
Sequence:CCGGCCGAAGGTACAAGTTGCAGAACTCGAGTTCTGCAACTTGTACCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_020442.3-2886s1c1
Sequence:CCGGGCTCTTCGCTTTATCCTCAATCTCGAGATTGAGGATAAAGCGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_020442.3-864s1c1
Sequence:CCGGCCTAAGGAGTTAGTATTGTATCTCGAGATACAATACTAACTCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020442.3-2373s1c1
Sequence:CCGGGATGTCCTAGACACATGGTTTCTCGAGAAACCATGTGTCTAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203526    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020442.3-3862s1c1
Sequence:CCGGGTCTTTGAGGACAAACAGATTCTCGAGAATCTGTTTGTCCTCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020442.3-1174s1c1
Sequence:CCGGCTGGTTCAGATCATGCAGGAACTCGAGTTCCTGCATGATCTGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020442.3-1692s1c1
Sequence:CCGGGACTCGCGATACACACATCTACTCGAGTAGATGTGTGTATCGCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175137
VARS2 MISSION shRNA Bacterial Glycerol Stock
valyl-tRNA synthetase 2, mitochondrial
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175137.3-3411s1c1
Sequence:CCGGCCCTCCATCTGGAATTGTCAACTCGAGTTGACAATTCCAGATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175137.3-1379s1c1
Sequence:CCGGGACCCGAGATACACGCATTTACTCGAGTAAATGCGTGTATCTCGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175137.3-1382s1c1
Sequence:CCGGCCGAGATACACGCATTTACATCTCGAGATGTAAATGCGTGTATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175137.3-555s1c1
Sequence:CCGGAGGAGGTAGTATTGTATGAAACTCGAGTTTCATACAATACTACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175137.3-2749s1c1
Sequence:CCGGGTATCATTTCTGGCTCCACAACTCGAGTTGTGGAGCCAGAAATGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175137
VARS2 MISSION shRNA shRNA Plasmid DNA
valyl-tRNA synthetase 2, mitochondrial
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175137.3-3411s1c1
Sequence:CCGGCCCTCCATCTGGAATTGTCAACTCGAGTTGACAATTCCAGATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175137.3-1379s1c1
Sequence:CCGGGACCCGAGATACACGCATTTACTCGAGTAAATGCGTGTATCTCGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175137.3-1382s1c1
Sequence:CCGGCCGAGATACACGCATTTACATCTCGAGATGTAAATGCGTGTATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175137.3-555s1c1
Sequence:CCGGAGGAGGTAGTATTGTATGAAACTCGAGTTTCATACAATACTACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175137.3-2749s1c1
Sequence:CCGGGTATCATTTCTGGCTCCACAACTCGAGTTGTGGAGCCAGAAATGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175137
VARS2 MISSION shRNA Lentiviral Transduction Particles
valyl-tRNA synthetase 2, mitochondrial
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175137.3-3411s1c1
Sequence:CCGGCCCTCCATCTGGAATTGTCAACTCGAGTTGACAATTCCAGATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175137.3-1379s1c1
Sequence:CCGGGACCCGAGATACACGCATTTACTCGAGTAAATGCGTGTATCTCGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175137.3-1382s1c1
Sequence:CCGGCCGAGATACACGCATTTACATCTCGAGATGTAAATGCGTGTATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175137.3-555s1c1
Sequence:CCGGAGGAGGTAGTATTGTATGAAACTCGAGTTTCATACAATACTACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175137.3-2749s1c1
Sequence:CCGGGTATCATTTCTGGCTCCACAACTCGAGTTGTGGAGCCAGAAATGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks