EMAIL THIS PAGE TO A FRIEND

VARS

valyl-tRNA synthetase

Synonyms: G7A VARS1 VARS2
UniProtKB ID: P26640, B0V1N1, Q5JQ90, Q96E77, Q9UQM2
Gene ID:
Human(7407) Summary: Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. The protein encoded by this gene belongs to class-I aminoacyl-tRNA synthetase family and is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
Mouse(22321) valyl-tRNA synthetase
Rat(25009) valyl-tRNA synthetase
Zebrafish(114427) valyl-tRNA synthetase
dog(481716) valyl-tRNA synthetase
Horse(100058924) valyl-tRNA synthetase
domestic cat(101090770) valyl-tRNA synthetase
naked mole-rat(101701358) valyl-tRNA synthetase
Domestic Rabbit(100353025) valyl-tRNA synthetase
domestic guinea pig(100720166) valyl-tRNA synthetase
cow(505556) valyl-tRNA synthetase
sheep(101102849) valyl-tRNA synthetase
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011690 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011690 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011690 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006295 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006295 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006295 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006295 Rosetta Predictions human pricing
NM_053292 Rosetta Predictions rat pricing
XM_342092 Rosetta Predictions rat pricing
NM_011690 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157061 predicted 1679
2 SASI_Hs01_00157062 predicted 1379
3 SASI_Hs01_00157064 predicted 1870
4 SASI_Hs01_00157065 predicted 1694
5 SASI_Hs01_00157066 predicted 2838
6 SASI_Hs01_00157067 predicted 2021
7 SASI_Hs01_00157068 predicted 4041
8 SASI_Hs01_00157069 predicted 3473
9 SASI_Hs02_00341300 predicted 1787
10 SASI_Hs01_00157070 predicted 3490
11 SASI_Hs01_00157063 predicted 2746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053292 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265659 predicted 2954
2 SASI_Rn02_00265660 predicted 2310
3 SASI_Rn02_00265661 predicted 1717
4 SASI_Rn02_00265662 predicted 2606
5 SASI_Rn02_00265663 predicted 1776
6 SASI_Rn02_00265664 predicted 3523
7 SASI_Rn02_00265665 predicted 3123
8 SASI_Rn02_00265666 predicted 3184
9 SASI_Rn02_00265667 predicted 2873
10 SASI_Rn02_00265668 predicted 2469
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168872 predicted 1452
2 SASI_Rn01_00168873 predicted 3013
3 SASI_Rn01_00168874 predicted 2369
4 SASI_Rn01_00168875 predicted 1780
5 SASI_Rn01_00168876 predicted 2669
6 SASI_Rn01_00168877 predicted 1841
7 SASI_Rn01_00168878 predicted 3585
8 SASI_Rn01_00168879 predicted 3184
9 SASI_Rn01_00168880 predicted 3245
10 SASI_Rn01_00168881 predicted 2927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191550 predicted 1589
2 SASI_Mm01_00191551 predicted 3203
3 SASI_Mm01_00191552 predicted 2552
4 SASI_Mm01_00191553 predicted 2428
5 SASI_Mm01_00191554 predicted 1478
6 SASI_Mm01_00191555 predicted 640
7 SASI_Mm02_00321236 predicted 1506
8 SASI_Mm01_00191557 predicted 2783
9 SASI_Mm01_00191558 predicted 716
10 SASI_Mm01_00191559 predicted 2403
11 SASI_Mm01_00191556 predicted 1510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011690
VARS MISSION shRNA Bacterial Glycerol Stock
valyl-tRNA synthetase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011690.2-3532s1c1
Sequence:CCGGCCCGACTGTTTCTTGGAAGTACTCGAGTACTTCCAAGAAACAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011690.2-1858s1c1
Sequence:CCGGCCCATCGTCTTCGATGACTTTCTCGAGAAAGTCATCGAAGACGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011690.2-853s1c1
Sequence:CCGGGCAAAGAAACGGGAGAAACTACTCGAGTAGTTTCTCCCGTTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011690.2-2335s1c2
Sequence:CCGGGCCTACTTTATCACCGTCCATCTCGAGATGGACGGTGATAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011690.2-2265s1c2
Sequence:CCGGGCATTCTTGGATGGACAACATCTCGAGATGTTGTCCATCCAAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011690
VARS MISSION shRNA shRNA Plasmid DNA
valyl-tRNA synthetase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011690.2-3532s1c1
Sequence:CCGGCCCGACTGTTTCTTGGAAGTACTCGAGTACTTCCAAGAAACAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011690.2-1858s1c1
Sequence:CCGGCCCATCGTCTTCGATGACTTTCTCGAGAAAGTCATCGAAGACGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011690.2-853s1c1
Sequence:CCGGGCAAAGAAACGGGAGAAACTACTCGAGTAGTTTCTCCCGTTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011690.2-2335s1c2
Sequence:CCGGGCCTACTTTATCACCGTCCATCTCGAGATGGACGGTGATAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011690.2-2265s1c2
Sequence:CCGGGCATTCTTGGATGGACAACATCTCGAGATGTTGTCCATCCAAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011690
VARS MISSION shRNA Lentiviral Transduction Particles
valyl-tRNA synthetase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011690.2-3532s1c1
Sequence:CCGGCCCGACTGTTTCTTGGAAGTACTCGAGTACTTCCAAGAAACAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011690.2-1858s1c1
Sequence:CCGGCCCATCGTCTTCGATGACTTTCTCGAGAAAGTCATCGAAGACGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011690.2-853s1c1
Sequence:CCGGGCAAAGAAACGGGAGAAACTACTCGAGTAGTTTCTCCCGTTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011690.2-2335s1c2
Sequence:CCGGGCCTACTTTATCACCGTCCATCTCGAGATGGACGGTGATAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011690.2-2265s1c2
Sequence:CCGGGCATTCTTGGATGGACAACATCTCGAGATGTTGTCCATCCAAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006295
VALIDATED
VARS MISSION shRNA Bacterial Glycerol Stock
valyl-tRNA synthetase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006295.1-2840s1c1
Sequence:CCGGCCTGGATGTCATCTATGGAATCTCGAGATTCCATAGATGACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006295.1-3294s1c1
Sequence:CCGGGTCTACTTGGAGTGCCTGAAACTCGAGTTTCAGGCACTCCAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006295.1-830s1c1
Sequence:CCGGGCTAGGAGAAGTGGTTCTATACTCGAGTATAGAACCACTTCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006295.1-1938s1c1
Sequence:CCGGCTTCCCATTGTCTTCGATGAACTCGAGTTCATCGAAGACAATGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006295.1-1763s1c1
Sequence:CCGGCCTCGTGTCCTTTGCCTATAACTCGAGTTATAGGCAAAGGACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006295.2-2609s21c1
Sequence:CCGGATCGCATCCCAGCCTACTTTGCTCGAGCAAAGTAGGCTGGGATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006295.2-3496s21c1
Sequence:CCGGGTCTACTTGGAGTGCCTGAAACTCGAGTTTCAGGCACTCCAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006295.2-1965s21c1
Sequence:CCGGCCTCGTGTCCTTTGCCTATAACTCGAGTTATAGGCAAAGGACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006295.2-2140s21c1
Sequence:CCGGCTTCCCATTGTCTTCGATGAACTCGAGTTCATCGAAGACAATGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006295.2-725s21c1
Sequence:CCGGGTTACGCCGACACGGAGTTAACTCGAGTTAACTCCGTGTCGGCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006295
VALIDATED
VARS MISSION shRNA shRNA Plasmid DNA
valyl-tRNA synthetase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006295.1-2840s1c1
Sequence:CCGGCCTGGATGTCATCTATGGAATCTCGAGATTCCATAGATGACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006295.1-3294s1c1
Sequence:CCGGGTCTACTTGGAGTGCCTGAAACTCGAGTTTCAGGCACTCCAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006295.1-830s1c1
Sequence:CCGGGCTAGGAGAAGTGGTTCTATACTCGAGTATAGAACCACTTCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006295.1-1938s1c1
Sequence:CCGGCTTCCCATTGTCTTCGATGAACTCGAGTTCATCGAAGACAATGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006295.1-1763s1c1
Sequence:CCGGCCTCGTGTCCTTTGCCTATAACTCGAGTTATAGGCAAAGGACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006295.2-2609s21c1
Sequence:CCGGATCGCATCCCAGCCTACTTTGCTCGAGCAAAGTAGGCTGGGATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006295.2-3496s21c1
Sequence:CCGGGTCTACTTGGAGTGCCTGAAACTCGAGTTTCAGGCACTCCAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006295.2-1965s21c1
Sequence:CCGGCCTCGTGTCCTTTGCCTATAACTCGAGTTATAGGCAAAGGACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006295.2-2140s21c1
Sequence:CCGGCTTCCCATTGTCTTCGATGAACTCGAGTTCATCGAAGACAATGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006295.2-725s21c1
Sequence:CCGGGTTACGCCGACACGGAGTTAACTCGAGTTAACTCCGTGTCGGCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006295
VALIDATED
VARS MISSION shRNA Lentiviral Transduction Particles
valyl-tRNA synthetase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006295.1-2840s1c1
Sequence:CCGGCCTGGATGTCATCTATGGAATCTCGAGATTCCATAGATGACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006295.1-3294s1c1
Sequence:CCGGGTCTACTTGGAGTGCCTGAAACTCGAGTTTCAGGCACTCCAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006295.1-830s1c1
Sequence:CCGGGCTAGGAGAAGTGGTTCTATACTCGAGTATAGAACCACTTCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006295.1-1938s1c1
Sequence:CCGGCTTCCCATTGTCTTCGATGAACTCGAGTTCATCGAAGACAATGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006295.1-1763s1c1
Sequence:CCGGCCTCGTGTCCTTTGCCTATAACTCGAGTTATAGGCAAAGGACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006295.2-2609s21c1
Sequence:CCGGATCGCATCCCAGCCTACTTTGCTCGAGCAAAGTAGGCTGGGATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006295.2-3496s21c1
Sequence:CCGGGTCTACTTGGAGTGCCTGAAACTCGAGTTTCAGGCACTCCAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006295.2-1965s21c1
Sequence:CCGGCCTCGTGTCCTTTGCCTATAACTCGAGTTATAGGCAAAGGACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006295.2-2140s21c1
Sequence:CCGGCTTCCCATTGTCTTCGATGAACTCGAGTTCATCGAAGACAATGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006295.2-725s21c1
Sequence:CCGGGTTACGCCGACACGGAGTTAACTCGAGTTAACTCCGTGTCGGCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks