EMAIL THIS PAGE TO A FRIEND

VASH1

vasohibin 1

Synonyms: KIAA1036
UniProtKB ID: Q7L8A9, Q96H02, Q9UBF4, Q9Y629
Gene ID:
Mouse(238328) vasohibin 1
Rat(503052) vasohibin 1
chicken(423369) vasohibin 1
dog(490799) vasohibin 1
Horse(100051887) vasohibin 1
cow(615419) vasohibin 1
sheep(101112736) vasohibin 1
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177354 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177354 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177354 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014909 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014909 Rosetta Predictions human pricing
XM_001058397 Rosetta Predictions rat pricing
XM_578575 Rosetta Predictions rat pricing
NM_177354 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041762 predicted 1816
2 SASI_Hs01_00041764 predicted 1784
3 SASI_Hs01_00041765 predicted 1439
4 SASI_Hs02_00346548 predicted 1406
5 SASI_Hs01_00041766 predicted 1518
6 SASI_Hs01_00041767 predicted 1254
7 SASI_Hs01_00041768 predicted 2206
8 SASI_Hs01_00041769 predicted 1835
9 SASI_Hs01_00041770 predicted 1740
10 SASI_Hs01_00041771 predicted 1014
11 SASI_Hs01_00041763 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289554 predicted 1634
2 SASI_Rn02_00289555 predicted 1632
3 SASI_Rn02_00289556 predicted 1917
4 SASI_Rn02_00289557 predicted 1915
5 SASI_Rn02_00289558 predicted 1624
6 SASI_Rn02_00289559 predicted 2130
7 SASI_Rn02_00289560 predicted 2212
8 SASI_Rn02_00289561 predicted 2121
9 SASI_Rn02_00289562 predicted 2473
10 SASI_Rn02_00289563 predicted 2473
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578575 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408126 predicted 1630
2 SASI_Rn02_00408127 predicted 1627
3 SASI_Rn02_00408128 predicted 1914
4 SASI_Rn02_00408129 predicted 1914
5 SASI_Rn02_00408130 predicted 1622
6 SASI_Rn02_00408131 predicted 1915
7 SASI_Rn02_00408132 predicted 1980
8 SASI_Rn02_00408133 predicted 1794
9 SASI_Rn02_00408134 predicted 1643
10 SASI_Rn02_00408135 predicted 1727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044249 predicted 1633
2 SASI_Mm01_00044250 predicted 2026
3 SASI_Mm01_00044251 predicted 2214
4 SASI_Mm01_00044252 predicted 2094
5 SASI_Mm01_00044253 predicted 1793
6 SASI_Mm01_00044254 predicted 1917
7 SASI_Mm01_00044255 predicted 1916
8 SASI_Mm01_00044256 predicted 1618
9 SASI_Mm01_00044257 predicted 2120
10 SASI_Mm01_00044258 predicted 2211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177354
VASH1 MISSION shRNA Bacterial Glycerol Stock
vasohibin 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000194532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177354.2-2140s1c1
Sequence:CCGGGATTGAATGGAAGCACTCGGTCTCGAGACCGAGTGCTTCCATTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177354.2-1903s1c1
Sequence:CCGGCAAGACCTATTTCTCAGGGAACTCGAGTTCCCTGAGAAATAGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177354.2-1734s1c2
Sequence:CCGGCAGGGACACAATTCTTTGAAACTCGAGTTTCAAAGAATTGTGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177354.2-1887s1c1
Sequence:CCGGGCTTTCCCATCAGCTTCAAGACTCGAGTCTTGAAGCTGATGGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177354
VASH1 MISSION shRNA shRNA Plasmid DNA
vasohibin 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000194532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177354.2-2140s1c1
Sequence:CCGGGATTGAATGGAAGCACTCGGTCTCGAGACCGAGTGCTTCCATTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177354.2-1903s1c1
Sequence:CCGGCAAGACCTATTTCTCAGGGAACTCGAGTTCCCTGAGAAATAGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177354.2-1734s1c2
Sequence:CCGGCAGGGACACAATTCTTTGAAACTCGAGTTTCAAAGAATTGTGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177354.2-1887s1c1
Sequence:CCGGGCTTTCCCATCAGCTTCAAGACTCGAGTCTTGAAGCTGATGGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177354
VASH1 MISSION shRNA Lentiviral Transduction Particles
vasohibin 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000194532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177354.2-2140s1c1
Sequence:CCGGGATTGAATGGAAGCACTCGGTCTCGAGACCGAGTGCTTCCATTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177354.2-1903s1c1
Sequence:CCGGCAAGACCTATTTCTCAGGGAACTCGAGTTCCCTGAGAAATAGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177354.2-1734s1c2
Sequence:CCGGCAGGGACACAATTCTTTGAAACTCGAGTTTCAAAGAATTGTGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177354.2-1887s1c1
Sequence:CCGGGCTTTCCCATCAGCTTCAAGACTCGAGTCTTGAAGCTGATGGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014909
VASH1 MISSION shRNA Bacterial Glycerol Stock
vasohibin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014909.2-1025s1c1
Sequence:CCGGGAGCTGCAGTACAATCACACACTCGAGTGTGTGATTGTACTGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014909.2-1156s1c1
Sequence:CCGGCCTGGGAATTTACCTCACCAACTCGAGTTGGTGAGGTAAATTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014909.2-1218s1c1
Sequence:CCGGCCTACTTCTCAGGGAACTACTCTCGAGAGTAGTTCCCTGAGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014909.2-1127s1c1
Sequence:CCGGCTGCCAATCAAATGCCTGGAACTCGAGTTCCAGGCATTTGATTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014909.2-4437s1c1
Sequence:CCGGCACAGGACATAGTGGTGCTTTCTCGAGAAAGCACCACTATGTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014909.2-1061s1c1
Sequence:CCGGGAAATTAAGAAGAGCAGACCTCTCGAGAGGTCTGCTCTTCTTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014909.4-2214s21c1
Sequence:CCGGGGCCTAGAGGCCGTTAGTATTCTCGAGAATACTAACGGCCTCTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014909.4-1986s21c1
Sequence:CCGGCAAAGCCATGCCAGACCTTAACTCGAGTTAAGGTCTGGCATGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014909.4-2257s21c1
Sequence:CCGGCAACTGAAGTTTAAGGTATTTCTCGAGAAATACCTTAAACTTCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014909
VASH1 MISSION shRNA shRNA Plasmid DNA
vasohibin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014909.2-1025s1c1
Sequence:CCGGGAGCTGCAGTACAATCACACACTCGAGTGTGTGATTGTACTGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014909.2-1156s1c1
Sequence:CCGGCCTGGGAATTTACCTCACCAACTCGAGTTGGTGAGGTAAATTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014909.2-1218s1c1
Sequence:CCGGCCTACTTCTCAGGGAACTACTCTCGAGAGTAGTTCCCTGAGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014909.2-1127s1c1
Sequence:CCGGCTGCCAATCAAATGCCTGGAACTCGAGTTCCAGGCATTTGATTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014909.2-4437s1c1
Sequence:CCGGCACAGGACATAGTGGTGCTTTCTCGAGAAAGCACCACTATGTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014909.2-1061s1c1
Sequence:CCGGGAAATTAAGAAGAGCAGACCTCTCGAGAGGTCTGCTCTTCTTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014909.4-2214s21c1
Sequence:CCGGGGCCTAGAGGCCGTTAGTATTCTCGAGAATACTAACGGCCTCTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014909.4-1986s21c1
Sequence:CCGGCAAAGCCATGCCAGACCTTAACTCGAGTTAAGGTCTGGCATGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014909.4-2257s21c1
Sequence:CCGGCAACTGAAGTTTAAGGTATTTCTCGAGAAATACCTTAAACTTCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014909
VASH1 MISSION shRNA Lentiviral Transduction Particles
vasohibin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014909.2-1025s1c1
Sequence:CCGGGAGCTGCAGTACAATCACACACTCGAGTGTGTGATTGTACTGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014909.2-1156s1c1
Sequence:CCGGCCTGGGAATTTACCTCACCAACTCGAGTTGGTGAGGTAAATTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014909.2-1218s1c1
Sequence:CCGGCCTACTTCTCAGGGAACTACTCTCGAGAGTAGTTCCCTGAGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014909.2-1127s1c1
Sequence:CCGGCTGCCAATCAAATGCCTGGAACTCGAGTTCCAGGCATTTGATTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014909.2-4437s1c1
Sequence:CCGGCACAGGACATAGTGGTGCTTTCTCGAGAAAGCACCACTATGTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014909.2-1061s1c1
Sequence:CCGGGAAATTAAGAAGAGCAGACCTCTCGAGAGGTCTGCTCTTCTTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014909.4-2214s21c1
Sequence:CCGGGGCCTAGAGGCCGTTAGTATTCTCGAGAATACTAACGGCCTCTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014909.4-1986s21c1
Sequence:CCGGCAAAGCCATGCCAGACCTTAACTCGAGTTAAGGTCTGGCATGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014909.4-2257s21c1
Sequence:CCGGCAACTGAAGTTTAAGGTATTTCTCGAGAAATACCTTAAACTTCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks