EMAIL THIS PAGE TO A FRIEND

VASH2

vasohibin 2

Synonyms: RP11-275G3.1
Gene ID:
Mouse(226841) vasohibin 2
Rat(498309) vasohibin 2
cow(539085) vasohibin 2
sheep(101113869) vasohibin 2
Zebrafish(562668) vasohibin 2
dog(608015) vasohibin 2
Horse(100053514) vasohibin 2
chicken(421364) vasohibin 2
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024749 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024749 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024749 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024749 Rosetta Predictions human pricing
NM_001109082 Rosetta Predictions rat pricing
NM_144879 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357235 predicted 1069
2 SASI_Hs01_00132629 predicted 1261
3 SASI_Hs01_00132630 predicted 1230
4 SASI_Hs01_00132631 predicted 991
5 SASI_Hs01_00132632 predicted 846
6 SASI_Hs01_00132633 predicted 1193
7 SASI_Hs01_00132634 predicted 1352
8 SASI_Hs01_00132635 predicted 662
9 SASI_Hs01_00132636 predicted 1372
10 SASI_Hs01_00132637 predicted 675
11 SASI_Hs01_00132638 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244950 predicted 1155
2 SASI_Rn02_00244951 predicted 618
3 SASI_Rn02_00244952 predicted 546
4 SASI_Rn02_00244953 predicted 910
5 SASI_Rn02_00244954 predicted 737
6 SASI_Rn02_00244955 predicted 631
7 SASI_Rn02_00244956 predicted 558
8 SASI_Rn02_00244957 predicted 696
9 SASI_Rn02_00244958 predicted 639
10 SASI_Rn02_00244959 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340324 predicted 869
2 SASI_Mm01_00037792 predicted 641
3 SASI_Mm01_00037794 predicted 575
4 SASI_Mm01_00037795 predicted 884
5 SASI_Mm01_00037796 predicted 1087
6 SASI_Mm01_00037797 predicted 987
7 SASI_Mm01_00037798 predicted 1235
8 SASI_Mm01_00037799 predicted 1356
9 SASI_Mm01_00037800 predicted 1218
10 SASI_Mm01_00037801 predicted 692
11 SASI_Mm01_00037793 predicted 1286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144879
VALIDATED
VASH2 MISSION shRNA Bacterial Glycerol Stock
vasohibin 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144879.2-1144s21c1
Sequence:CCGGGCACACGGTTAAGAAGGTCAACTCGAGTTGACCTTCTTAACCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144879.2-876s21c1
Sequence:CCGGGAGAATCCTTGCCTATCAAATCTCGAGATTTGATAGGCAAGGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144879.2-952s21c1
Sequence:CCGGGCGGTTCCCTATCAGCTTTAACTCGAGTTAAAGCTGATAGGGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144879.2-1015s21c1
Sequence:CCGGGATTTACTGCAACGGTTACTACTCGAGTAGTAACCGTTGCAGTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144879.1-722s1c1
Sequence:CCGGGCGGTTCCCTATCAGCTTTAACTCGAGTTAAAGCTGATAGGGAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144879.1-914s1c1
Sequence:CCGGGCACACGGTTAAGAAGGTCAACTCGAGTTGACCTTCTTAACCGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144879.1-785s1c1
Sequence:CCGGGATTTACTGCAACGGTTACTACTCGAGTAGTAACCGTTGCAGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144879.1-536s1c1
Sequence:CCGGCCAGAATTACATGAAGACTCTCTCGAGAGAGTCTTCATGTAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200258    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144879.1-2490s1c1
Sequence:CCGGCCGTCTGCTTATGGAGTCTTTCTCGAGAAAGACTCCATAAGCAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144879.1-2551s1c1
Sequence:CCGGCCACCCTTAAACCAGTATTATCTCGAGATAATACTGGTTTAAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144879.1-898s1c1
Sequence:CCGGCCTATAAGAAATACCTGCACACTCGAGTGTGCAGGTATTTCTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144879.1-578s1c1
Sequence:CCGGCCAGTTCTTTGAAATCAGGAACTCGAGTTCCTGATTTCAAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144879
VALIDATED
VASH2 MISSION shRNA shRNA Plasmid DNA
vasohibin 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144879.2-1144s21c1
Sequence:CCGGGCACACGGTTAAGAAGGTCAACTCGAGTTGACCTTCTTAACCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144879.2-876s21c1
Sequence:CCGGGAGAATCCTTGCCTATCAAATCTCGAGATTTGATAGGCAAGGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144879.2-952s21c1
Sequence:CCGGGCGGTTCCCTATCAGCTTTAACTCGAGTTAAAGCTGATAGGGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144879.2-1015s21c1
Sequence:CCGGGATTTACTGCAACGGTTACTACTCGAGTAGTAACCGTTGCAGTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144879.1-722s1c1
Sequence:CCGGGCGGTTCCCTATCAGCTTTAACTCGAGTTAAAGCTGATAGGGAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144879.1-914s1c1
Sequence:CCGGGCACACGGTTAAGAAGGTCAACTCGAGTTGACCTTCTTAACCGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144879.1-785s1c1
Sequence:CCGGGATTTACTGCAACGGTTACTACTCGAGTAGTAACCGTTGCAGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144879.1-536s1c1
Sequence:CCGGCCAGAATTACATGAAGACTCTCTCGAGAGAGTCTTCATGTAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200258    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144879.1-2490s1c1
Sequence:CCGGCCGTCTGCTTATGGAGTCTTTCTCGAGAAAGACTCCATAAGCAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144879.1-2551s1c1
Sequence:CCGGCCACCCTTAAACCAGTATTATCTCGAGATAATACTGGTTTAAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144879.1-898s1c1
Sequence:CCGGCCTATAAGAAATACCTGCACACTCGAGTGTGCAGGTATTTCTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144879.1-578s1c1
Sequence:CCGGCCAGTTCTTTGAAATCAGGAACTCGAGTTCCTGATTTCAAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144879
VALIDATED
VASH2 MISSION shRNA Lentiviral Transduction Particles
vasohibin 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144879.2-1144s21c1
Sequence:CCGGGCACACGGTTAAGAAGGTCAACTCGAGTTGACCTTCTTAACCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144879.2-876s21c1
Sequence:CCGGGAGAATCCTTGCCTATCAAATCTCGAGATTTGATAGGCAAGGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144879.2-952s21c1
Sequence:CCGGGCGGTTCCCTATCAGCTTTAACTCGAGTTAAAGCTGATAGGGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144879.2-1015s21c1
Sequence:CCGGGATTTACTGCAACGGTTACTACTCGAGTAGTAACCGTTGCAGTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144879.1-722s1c1
Sequence:CCGGGCGGTTCCCTATCAGCTTTAACTCGAGTTAAAGCTGATAGGGAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144879.1-914s1c1
Sequence:CCGGGCACACGGTTAAGAAGGTCAACTCGAGTTGACCTTCTTAACCGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144879.1-785s1c1
Sequence:CCGGGATTTACTGCAACGGTTACTACTCGAGTAGTAACCGTTGCAGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144879.1-536s1c1
Sequence:CCGGCCAGAATTACATGAAGACTCTCTCGAGAGAGTCTTCATGTAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200258    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144879.1-2490s1c1
Sequence:CCGGCCGTCTGCTTATGGAGTCTTTCTCGAGAAAGACTCCATAAGCAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144879.1-2551s1c1
Sequence:CCGGCCACCCTTAAACCAGTATTATCTCGAGATAATACTGGTTTAAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144879.1-898s1c1
Sequence:CCGGCCTATAAGAAATACCTGCACACTCGAGTGTGCAGGTATTTCTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144879.1-578s1c1
Sequence:CCGGCCAGTTCTTTGAAATCAGGAACTCGAGTTCCTGATTTCAAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024749
VALIDATED
VASH2 MISSION shRNA Bacterial Glycerol Stock
vasohibin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000220024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024749.2-996s1c1
Sequence:CCGGAGATGCTGAGGGCTGACATAACTCGAGTTATGTCAGCCCTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024749.2-866s1c1
Sequence:CCGGTTTGACTTTGAGGACTCTTACCTCGAGGTAAGAGTCCTCAAAGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024749.2-910s1c1
Sequence:CCGGGAAGGTCAAGATTGGGCTGTACTCGAGTACAGCCCAATCTTGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024749.2-736s1c1
Sequence:CCGGCTCAGGAAACTACTTTCACCACTCGAGTGGTGAAAGTAGTTTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024749.2-3051s1c1
Sequence:CCGGGCCACATGTATTCAGATGTTTCTCGAGAAACATCTGAATACATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163154    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024749.2-2198s1c1
Sequence:CCGGGCAGGCTTTGATTCTTCTGAACTCGAGTTCAGAAGAATCAAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024749.2-1039s1c1
Sequence:CCGGCAGGGACATGAGAATGAAGATCTCGAGATCTTCATTCTCATGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024749.2-1214s1c1
Sequence:CCGGCTGAATGAAGTGGGCTATCAACTCGAGTTGATAGCCCACTTCATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024749.2-652s1c1
Sequence:CCGGCCAGAATTACATGAAGACCCTCTCGAGAGGGTCTTCATGTAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024749.2-573s1c1
Sequence:CCGGCCTTCTTGGCAAAGCCTTCAACTCGAGTTGAAGGCTTTGCCAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024749
VALIDATED
VASH2 MISSION shRNA shRNA Plasmid DNA
vasohibin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000220024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024749.2-996s1c1
Sequence:CCGGAGATGCTGAGGGCTGACATAACTCGAGTTATGTCAGCCCTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024749.2-866s1c1
Sequence:CCGGTTTGACTTTGAGGACTCTTACCTCGAGGTAAGAGTCCTCAAAGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024749.2-910s1c1
Sequence:CCGGGAAGGTCAAGATTGGGCTGTACTCGAGTACAGCCCAATCTTGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024749.2-736s1c1
Sequence:CCGGCTCAGGAAACTACTTTCACCACTCGAGTGGTGAAAGTAGTTTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024749.2-3051s1c1
Sequence:CCGGGCCACATGTATTCAGATGTTTCTCGAGAAACATCTGAATACATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163154    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024749.2-2198s1c1
Sequence:CCGGGCAGGCTTTGATTCTTCTGAACTCGAGTTCAGAAGAATCAAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024749.2-1039s1c1
Sequence:CCGGCAGGGACATGAGAATGAAGATCTCGAGATCTTCATTCTCATGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024749.2-1214s1c1
Sequence:CCGGCTGAATGAAGTGGGCTATCAACTCGAGTTGATAGCCCACTTCATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024749.2-652s1c1
Sequence:CCGGCCAGAATTACATGAAGACCCTCTCGAGAGGGTCTTCATGTAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024749.2-573s1c1
Sequence:CCGGCCTTCTTGGCAAAGCCTTCAACTCGAGTTGAAGGCTTTGCCAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024749
VALIDATED
VASH2 MISSION shRNA Lentiviral Transduction Particles
vasohibin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000220024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024749.2-996s1c1
Sequence:CCGGAGATGCTGAGGGCTGACATAACTCGAGTTATGTCAGCCCTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024749.2-866s1c1
Sequence:CCGGTTTGACTTTGAGGACTCTTACCTCGAGGTAAGAGTCCTCAAAGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024749.2-910s1c1
Sequence:CCGGGAAGGTCAAGATTGGGCTGTACTCGAGTACAGCCCAATCTTGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024749.2-736s1c1
Sequence:CCGGCTCAGGAAACTACTTTCACCACTCGAGTGGTGAAAGTAGTTTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024749.2-3051s1c1
Sequence:CCGGGCCACATGTATTCAGATGTTTCTCGAGAAACATCTGAATACATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163154    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024749.2-2198s1c1
Sequence:CCGGGCAGGCTTTGATTCTTCTGAACTCGAGTTCAGAAGAATCAAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024749.2-1039s1c1
Sequence:CCGGCAGGGACATGAGAATGAAGATCTCGAGATCTTCATTCTCATGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024749.2-1214s1c1
Sequence:CCGGCTGAATGAAGTGGGCTATCAACTCGAGTTGATAGCCCACTTCATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024749.2-652s1c1
Sequence:CCGGCCAGAATTACATGAAGACCCTCTCGAGAGGGTCTTCATGTAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024749.2-573s1c1
Sequence:CCGGCCTTCTTGGCAAAGCCTTCAACTCGAGTTGAAGGCTTTGCCAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks