EMAIL THIS PAGE TO A FRIEND
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139307 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139307 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139307 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138440 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138440 Rosetta Predictions human pricing
NM_001109382 Rosetta Predictions rat pricing
NM_139307 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124100 predicted 547
2 SASI_Hs01_00124101 predicted 780
3 SASI_Hs01_00124102 predicted 474
4 SASI_Hs02_00363600 predicted 1644
5 SASI_Hs01_00124104 predicted 955
6 SASI_Hs01_00124105 predicted 1737
7 SASI_Hs01_00124106 predicted 1450
8 SASI_Hs01_00124107 predicted 1734
9 SASI_Hs01_00124108 predicted 1862
10 SASI_Hs02_00363601 predicted 1129
11 SASI_Hs01_00124099 predicted 484
12 SASI_Hs01_00124103 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109382 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247866 predicted 2082
2 SASI_Rn02_00247867 predicted 550
3 SASI_Rn02_00247868 predicted 1073
4 SASI_Rn02_00247869 predicted 714
5 SASI_Rn02_00247870 predicted 2084
6 SASI_Rn02_00247871 predicted 400
7 SASI_Rn02_00247872 predicted 477
8 SASI_Rn02_00247873 predicted 441
9 SASI_Rn02_00247874 predicted 456
10 SASI_Rn02_00247875 predicted 1492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168830 predicted 1289
2 SASI_Mm01_00168831 predicted 412
3 SASI_Mm01_00168832 predicted 405
4 SASI_Mm01_00168833 predicted 604
5 SASI_Mm01_00168834 predicted 772
6 SASI_Mm01_00168835 predicted 1284
7 SASI_Mm01_00168836 predicted 674
8 SASI_Mm01_00168837 predicted 886
9 SASI_Mm01_00168838 predicted 541
10 SASI_Mm01_00168839 predicted 616
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139307
VALIDATED
VASN MISSION shRNA Bacterial Glycerol Stock
vasorin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139307.2-2245s1c1
Sequence:CCGGCAGAAGGAAGTTCTCAGTATACTCGAGTATACTGAGAACTTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139307.2-1106s1c1
Sequence:CCGGGCGTGAGAACCATGTTGTGTTCTCGAGAACACAACATGGTTCTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139307.2-2593s1c1
Sequence:CCGGGTGGATTTGCTTCTATTGTTTCTCGAGAAACAATAGAAGCAAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139307.2-1708s1c1
Sequence:CCGGCTGCTTCACTTGCAGAGTATACTCGAGTATACTCTGCAAGTGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139307.3-1155s21c1
Sequence:CCGGGCGTGAGAACCATGTTGTGTTCTCGAGAACACAACATGGTTCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139307.3-1279s21c1
Sequence:CCGGACGGCCACAGTACCTACTATACTCGAGTATAGTAGGTACTGTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139307.3-2642s21c1
Sequence:CCGGGTGGATTTGCTTCTATTGTTTCTCGAGAAACAATAGAAGCAAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139307.3-1729s21c1
Sequence:CCGGGACAAACGACTGGTGACATTACTCGAGTAATGTCACCAGTCGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139307.3-2294s21c1
Sequence:CCGGCAGAAGGAAGTTCTCAGTATACTCGAGTATACTGAGAACTTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139307
VALIDATED
VASN MISSION shRNA shRNA Plasmid DNA
vasorin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139307.2-2245s1c1
Sequence:CCGGCAGAAGGAAGTTCTCAGTATACTCGAGTATACTGAGAACTTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139307.2-1106s1c1
Sequence:CCGGGCGTGAGAACCATGTTGTGTTCTCGAGAACACAACATGGTTCTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139307.2-2593s1c1
Sequence:CCGGGTGGATTTGCTTCTATTGTTTCTCGAGAAACAATAGAAGCAAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139307.2-1708s1c1
Sequence:CCGGCTGCTTCACTTGCAGAGTATACTCGAGTATACTCTGCAAGTGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139307.3-1155s21c1
Sequence:CCGGGCGTGAGAACCATGTTGTGTTCTCGAGAACACAACATGGTTCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139307.3-1279s21c1
Sequence:CCGGACGGCCACAGTACCTACTATACTCGAGTATAGTAGGTACTGTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139307.3-2642s21c1
Sequence:CCGGGTGGATTTGCTTCTATTGTTTCTCGAGAAACAATAGAAGCAAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139307.3-1729s21c1
Sequence:CCGGGACAAACGACTGGTGACATTACTCGAGTAATGTCACCAGTCGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139307.3-2294s21c1
Sequence:CCGGCAGAAGGAAGTTCTCAGTATACTCGAGTATACTGAGAACTTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139307
VALIDATED
VASN MISSION shRNA Lentiviral Transduction Particles
vasorin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139307.2-2245s1c1
Sequence:CCGGCAGAAGGAAGTTCTCAGTATACTCGAGTATACTGAGAACTTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139307.2-1106s1c1
Sequence:CCGGGCGTGAGAACCATGTTGTGTTCTCGAGAACACAACATGGTTCTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139307.2-2593s1c1
Sequence:CCGGGTGGATTTGCTTCTATTGTTTCTCGAGAAACAATAGAAGCAAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139307.2-1708s1c1
Sequence:CCGGCTGCTTCACTTGCAGAGTATACTCGAGTATACTCTGCAAGTGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139307.3-1155s21c1
Sequence:CCGGGCGTGAGAACCATGTTGTGTTCTCGAGAACACAACATGGTTCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139307.3-1279s21c1
Sequence:CCGGACGGCCACAGTACCTACTATACTCGAGTATAGTAGGTACTGTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139307.3-2642s21c1
Sequence:CCGGGTGGATTTGCTTCTATTGTTTCTCGAGAAACAATAGAAGCAAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139307.3-1729s21c1
Sequence:CCGGGACAAACGACTGGTGACATTACTCGAGTAATGTCACCAGTCGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139307.3-2294s21c1
Sequence:CCGGCAGAAGGAAGTTCTCAGTATACTCGAGTATACTGAGAACTTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138440
VALIDATED
VASN MISSION shRNA Bacterial Glycerol Stock
vasorin
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138440.1-452s1c1
Sequence:CCGGGCTGCATGAAATCACCAATGACTCGAGTCATTGGTGATTTCATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138440.2-2682s21c1
Sequence:CCGGGAGATCCTTTCCCATTTATTCCTCGAGGAATAAATGGGAAAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138440.2-1177s21c1
Sequence:CCGGAGCTTGACTACGCCGACTTTGCTCGAGCAAAGTCGGCGTAGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138440.2-2158s21c1
Sequence:CCGGACGCAAAGCCCTACATCTAAGCTCGAGCTTAGATGTAGGGCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138440.2-1640s21c1
Sequence:CCGGTCTCACCTATCGCAACCTATCCTCGAGGATAGGTTGCGATAGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138440.2-479s21c1
Sequence:CCGGAGCCAACAGGCTGCATGAAATCTCGAGATTTCATGCAGCCTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138440
VALIDATED
VASN MISSION shRNA shRNA Plasmid DNA
vasorin
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138440.1-452s1c1
Sequence:CCGGGCTGCATGAAATCACCAATGACTCGAGTCATTGGTGATTTCATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138440.2-2682s21c1
Sequence:CCGGGAGATCCTTTCCCATTTATTCCTCGAGGAATAAATGGGAAAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138440.2-1177s21c1
Sequence:CCGGAGCTTGACTACGCCGACTTTGCTCGAGCAAAGTCGGCGTAGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138440.2-2158s21c1
Sequence:CCGGACGCAAAGCCCTACATCTAAGCTCGAGCTTAGATGTAGGGCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138440.2-1640s21c1
Sequence:CCGGTCTCACCTATCGCAACCTATCCTCGAGGATAGGTTGCGATAGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138440.2-479s21c1
Sequence:CCGGAGCCAACAGGCTGCATGAAATCTCGAGATTTCATGCAGCCTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138440
VALIDATED
VASN MISSION shRNA Lentiviral Transduction Particles
vasorin
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138440.1-452s1c1
Sequence:CCGGGCTGCATGAAATCACCAATGACTCGAGTCATTGGTGATTTCATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138440.2-2682s21c1
Sequence:CCGGGAGATCCTTTCCCATTTATTCCTCGAGGAATAAATGGGAAAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138440.2-1177s21c1
Sequence:CCGGAGCTTGACTACGCCGACTTTGCTCGAGCAAAGTCGGCGTAGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138440.2-2158s21c1
Sequence:CCGGACGCAAAGCCCTACATCTAAGCTCGAGCTTAGATGTAGGGCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138440.2-1640s21c1
Sequence:CCGGTCTCACCTATCGCAACCTATCCTCGAGGATAGGTTGCGATAGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138440.2-479s21c1
Sequence:CCGGAGCCAACAGGCTGCATGAAATCTCGAGATTTCATGCAGCCTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks