EMAIL THIS PAGE TO A FRIEND

VASP

vasodilator-stimulated phosphoprotein

UniProtKB ID: P50552, B2RBT9, Q6PIZ1, Q93035
Gene ID:
Human(7408) Summary: Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In the mid-region of the protein, family members have a proline-rich domain that binds SH3 and WW domain-containing proteins. Their C-terminal EVH2 domain mediates tetramerization and binds both G and F actin. VASP is associated with filamentous actin formation and likely plays a widespread role in cell adhesion and motility. VASP may also be involved in the intracellular signaling pathways that regulate integrin-extracellular matrix interactions. VASP is regulated by the cyclic nucleotide-dependent kinases PKA and PKG. [provided by RefSeq, Jul 2008]
Mouse(22323) vasodilator-stimulated phosphoprotein
Rat(361517) vasodilator-stimulated phosphoprotein
Zebrafish(550487) vasodilator-stimulated phosphoprotein
dog(403936) vasodilator-stimulated phosphoprotein
domestic cat(101094805) vasodilator-stimulated phosphoprotein
domestic guinea pig(100722137) vasodilator-stimulated phosphoprotein
naked mole-rat(101708295) vasodilator-stimulated phosphoprotein
cow(514902) vasodilator-stimulated phosphoprotein
sheep(101113616) vasodilator-stimulated phosphoprotein
Gene Class: Cytoskeleton
137 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300172 Anti-phospho-VASP (pSer157) antibody produced in rabbit affinity isolated antibody human, rat
immunohistochemistry, western blot pricing
SAB4504564 Anti-phospho-VASP (pSer157) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504565 Anti-phospho-VASP (pSer238) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4300129 Anti-phospho-VASP (pSer239) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4200280 Anti-phospho-VASP [pSer157] antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
western blot pricing
SAB4200555 Anti-phospho-VASP [pSer239] antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody mouse, human, dog, rat
immunofluorescence, western blot pricing
SAB4200521 Anti-phospho-VASP [pThr278] antibody produced in rabbit ~0.1 mg/mL, affinity isolated antibody human, mouse, rat
immunoprecipitation, western blot pricing
SAB4300467 Anti-VASP (Ab-157) antibody produced in rabbit affinity isolated antibody human, mouse
immunofluorescence, western blot pricing
SAB4300436 Anti-VASP (Ab-239) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
V3390 Anti-VASP (C-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution human, canine, rat
immunofluorescence, western blot pricing
SAB1406577 Anti-VASP antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA005724 Anti-VASP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
V3515 Anti-VASP antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution human, canine
immunofluorescence, western blot pricing
SAB4503064 Anti-VASP antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4503065 Anti-VASP antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003370 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008736 Rosetta Predictions human pricing
NM_003370 Rosetta Predictions human pricing
NM_001108475 Rosetta Predictions rat pricing
NM_009499 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138054 predicted 1102
2 SASI_Hs01_00138055 predicted 834
3 SASI_Hs01_00138056 predicted 1078
4 SASI_Hs01_00138057 predicted 801
5 SASI_Hs01_00138058 predicted 910
6 SASI_Hs01_00138059 predicted 959
7 SASI_Hs01_00138060 predicted 1045
8 SASI_Hs01_00138061 predicted 972
9 SASI_Hs01_00138062 predicted 984
10 SASI_Hs01_00138063 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335524 predicted 430
2 SASI_Hs02_00335525 predicted 1496
3 SASI_Hs01_00085075 predicted 1529
4 SASI_Hs02_00335526 predicted 1189
5 SASI_Hs01_00085076 predicted 1239
6 SASI_Hs02_00335527 predicted 1274
7 SASI_Hs01_00085077 predicted 1349
8 SASI_Hs01_00085078 predicted 1398
9 SASI_Hs02_00335528 predicted 1378
10 SASI_Hs02_00335529 predicted 1302
11 SASI_Hs01_00085073 predicted 1552
12 SASI_Hs01_00085074 predicted 1282
13 SASI_Hs01_00085079 predicted 1498
14 SASI_Hs01_00085080 predicted 1428
15 SASI_Hs01_00085081 predicted 1429
16 SASI_Hs01_00085082 predicted 1561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108475 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239009 predicted 357
2 SASI_Rn02_00239010 predicted 1051
3 SASI_Rn02_00239011 predicted 476
4 SASI_Rn02_00239012 predicted 392
5 SASI_Rn02_00239013 predicted 1375
6 SASI_Rn02_00239014 predicted 1423
7 SASI_Rn02_00239015 predicted 1102
8 SASI_Rn02_00239016 predicted 1053
9 SASI_Rn02_00239017 predicted 274
10 SASI_Rn02_00239018 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316266 predicted 1472
2 SASI_Mm02_00316267 predicted 422
3 SASI_Mm02_00316268 predicted 508
4 SASI_Mm02_00316269 predicted 1407
5 SASI_Mm02_00316270 predicted 457
6 SASI_Mm01_00080629 predicted 1218
7 SASI_Mm02_00316271 predicted 368
8 SASI_Mm02_00316272 predicted 363
9 SASI_Mm02_00316273 predicted 1260
10 SASI_Mm01_00080631 predicted 1217
11 SASI_Mm01_00080625 predicted 797
12 SASI_Mm01_00080626 predicted 228
13 SASI_Mm01_00080627 predicted 886
14 SASI_Mm01_00080628 predicted 223
15 SASI_Mm01_00080630 predicted 880
16 SASI_Mm01_00080632 predicted 847
17 SASI_Mm01_00080633 predicted 840
18 SASI_Mm01_00080634 predicted 866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003370
VALIDATED
VASP MISSION shRNA Bacterial Glycerol Stock
vasodilator-stimulated phosphoprotein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003370.3-370s21c1
Sequence:CCGGCGGGCCACTGTGATGCTTTATCTCGAGATAAAGCATCACAGTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003370.3-1412s21c1
Sequence:CCGGAGGAATTGCAGAAAGTGAAAGCTCGAGCTTTCACTTTCTGCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003370.3-1294s21c1
Sequence:CCGGCCAAGGATGAAGTCGTCTTCTCTCGAGAGAAGACGACTTCATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003370.3-1805s21c1
Sequence:CCGGCCCTTGTTCTAGATTCACTTTCTCGAGAAAGTGAATCTAGAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_003370.3-1354s21c1
Sequence:CCGGTCCAGTGATTACTCGGACCTACTCGAGTAGGTCCGAGTAATCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003370.3-1131s21c1
Sequence:CCGGCATGGAAGAGATGAACGCCATCTCGAGATGGCGTTCATCTCTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003370.3-1805s1c1
Sequence:CCGGCCCTTGTTCTAGATTCACTTTCTCGAGAAAGTGAATCTAGAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003370.3-1131s1c1
Sequence:CCGGCATGGAAGAGATGAACGCCATCTCGAGATGGCGTTCATCTCTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003370.3-1354s1c1
Sequence:CCGGTCCAGTGATTACTCGGACCTACTCGAGTAGGTCCGAGTAATCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003370.3-1294s1c1
Sequence:CCGGCCAAGGATGAAGTCGTCTTCTCTCGAGAGAAGACGACTTCATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003370
VALIDATED
VASP MISSION shRNA shRNA Plasmid DNA
vasodilator-stimulated phosphoprotein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003370.3-370s21c1
Sequence:CCGGCGGGCCACTGTGATGCTTTATCTCGAGATAAAGCATCACAGTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003370.3-1412s21c1
Sequence:CCGGAGGAATTGCAGAAAGTGAAAGCTCGAGCTTTCACTTTCTGCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003370.3-1294s21c1
Sequence:CCGGCCAAGGATGAAGTCGTCTTCTCTCGAGAGAAGACGACTTCATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003370.3-1805s21c1
Sequence:CCGGCCCTTGTTCTAGATTCACTTTCTCGAGAAAGTGAATCTAGAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_003370.3-1354s21c1
Sequence:CCGGTCCAGTGATTACTCGGACCTACTCGAGTAGGTCCGAGTAATCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003370.3-1131s21c1
Sequence:CCGGCATGGAAGAGATGAACGCCATCTCGAGATGGCGTTCATCTCTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003370.3-1805s1c1
Sequence:CCGGCCCTTGTTCTAGATTCACTTTCTCGAGAAAGTGAATCTAGAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003370.3-1131s1c1
Sequence:CCGGCATGGAAGAGATGAACGCCATCTCGAGATGGCGTTCATCTCTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003370.3-1354s1c1
Sequence:CCGGTCCAGTGATTACTCGGACCTACTCGAGTAGGTCCGAGTAATCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003370.3-1294s1c1
Sequence:CCGGCCAAGGATGAAGTCGTCTTCTCTCGAGAGAAGACGACTTCATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003370
VALIDATED
VASP MISSION shRNA Lentiviral Transduction Particles
vasodilator-stimulated phosphoprotein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003370.3-370s21c1
Sequence:CCGGCGGGCCACTGTGATGCTTTATCTCGAGATAAAGCATCACAGTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003370.3-1412s21c1
Sequence:CCGGAGGAATTGCAGAAAGTGAAAGCTCGAGCTTTCACTTTCTGCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003370.3-1294s21c1
Sequence:CCGGCCAAGGATGAAGTCGTCTTCTCTCGAGAGAAGACGACTTCATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003370.3-1805s21c1
Sequence:CCGGCCCTTGTTCTAGATTCACTTTCTCGAGAAAGTGAATCTAGAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_003370.3-1354s21c1
Sequence:CCGGTCCAGTGATTACTCGGACCTACTCGAGTAGGTCCGAGTAATCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003370.3-1131s21c1
Sequence:CCGGCATGGAAGAGATGAACGCCATCTCGAGATGGCGTTCATCTCTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003370.3-1805s1c1
Sequence:CCGGCCCTTGTTCTAGATTCACTTTCTCGAGAAAGTGAATCTAGAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003370.3-1131s1c1
Sequence:CCGGCATGGAAGAGATGAACGCCATCTCGAGATGGCGTTCATCTCTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003370.3-1354s1c1
Sequence:CCGGTCCAGTGATTACTCGGACCTACTCGAGTAGGTCCGAGTAATCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003370.3-1294s1c1
Sequence:CCGGCCAAGGATGAAGTCGTCTTCTCTCGAGAGAAGACGACTTCATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009499
VALIDATED
VASP MISSION shRNA Bacterial Glycerol Stock
vasodilator-stimulated phosphoprotein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009499.2-623s21c1
Sequence:CCGGAGGAGGACGCCATACAGTTTGCTCGAGCAAACTGTATGGCGTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009499.2-1410s21c1
Sequence:CCGGAGAGGAAATCATCGAAGTCTTCTCGAGAAGACTTCGATGATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009499.2-505s21c1
Sequence:CCGGGATCAGCAGGTGGTTATCAACCTCGAGGTTGATAACCACCTGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009499.2-365s21c1
Sequence:CCGGGGGCTACTGTGATGCTTTATGCTCGAGCATAAAGCATCACAGTAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009499.2-1941s21c1
Sequence:CCGGCCCATCGGAGGCAGCTATATACTCGAGTATATAGCTGCCTCCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009499.1-28s1c1
Sequence:CCGGCGGGCTACTGTGATGCTTTATCTCGAGATAAAGCATCACAGTAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009499.1-670s1c1
Sequence:CCGGGCTGCCATTGCTGGAGCCAAACTCGAGTTTGGCTCCAGCAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009499.1-130s1c1
Sequence:CCGGGCTAACTCCTTCCGAGTTGTTCTCGAGAACAACTCGGAAGGAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009499.1-296s1c1
Sequence:CCGGCCATACAGTTTGCAACAGGCACTCGAGTGCCTGTTGCAAACTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009499.1-890s1c1
Sequence:CCGGCCCAGAGTGAACCTGTGAGAACTCGAGTTCTCACAGGTTCACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009499
VALIDATED
VASP MISSION shRNA shRNA Plasmid DNA
vasodilator-stimulated phosphoprotein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009499.2-623s21c1
Sequence:CCGGAGGAGGACGCCATACAGTTTGCTCGAGCAAACTGTATGGCGTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009499.2-1410s21c1
Sequence:CCGGAGAGGAAATCATCGAAGTCTTCTCGAGAAGACTTCGATGATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009499.2-505s21c1
Sequence:CCGGGATCAGCAGGTGGTTATCAACCTCGAGGTTGATAACCACCTGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009499.2-365s21c1
Sequence:CCGGGGGCTACTGTGATGCTTTATGCTCGAGCATAAAGCATCACAGTAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009499.2-1941s21c1
Sequence:CCGGCCCATCGGAGGCAGCTATATACTCGAGTATATAGCTGCCTCCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009499.1-28s1c1
Sequence:CCGGCGGGCTACTGTGATGCTTTATCTCGAGATAAAGCATCACAGTAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009499.1-670s1c1
Sequence:CCGGGCTGCCATTGCTGGAGCCAAACTCGAGTTTGGCTCCAGCAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009499.1-130s1c1
Sequence:CCGGGCTAACTCCTTCCGAGTTGTTCTCGAGAACAACTCGGAAGGAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009499.1-296s1c1
Sequence:CCGGCCATACAGTTTGCAACAGGCACTCGAGTGCCTGTTGCAAACTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009499.1-890s1c1
Sequence:CCGGCCCAGAGTGAACCTGTGAGAACTCGAGTTCTCACAGGTTCACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009499
VALIDATED
VASP MISSION shRNA Lentiviral Transduction Particles
vasodilator-stimulated phosphoprotein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009499.2-623s21c1
Sequence:CCGGAGGAGGACGCCATACAGTTTGCTCGAGCAAACTGTATGGCGTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009499.2-1410s21c1
Sequence:CCGGAGAGGAAATCATCGAAGTCTTCTCGAGAAGACTTCGATGATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009499.2-505s21c1
Sequence:CCGGGATCAGCAGGTGGTTATCAACCTCGAGGTTGATAACCACCTGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009499.2-365s21c1
Sequence:CCGGGGGCTACTGTGATGCTTTATGCTCGAGCATAAAGCATCACAGTAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009499.2-1941s21c1
Sequence:CCGGCCCATCGGAGGCAGCTATATACTCGAGTATATAGCTGCCTCCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009499.1-28s1c1
Sequence:CCGGCGGGCTACTGTGATGCTTTATCTCGAGATAAAGCATCACAGTAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009499.1-670s1c1
Sequence:CCGGGCTGCCATTGCTGGAGCCAAACTCGAGTTTGGCTCCAGCAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009499.1-130s1c1
Sequence:CCGGGCTAACTCCTTCCGAGTTGTTCTCGAGAACAACTCGGAAGGAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009499.1-296s1c1
Sequence:CCGGCCATACAGTTTGCAACAGGCACTCGAGTGCCTGTTGCAAACTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009499.1-890s1c1
Sequence:CCGGCCCAGAGTGAACCTGTGAGAACTCGAGTTCTCACAGGTTCACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks