EMAIL THIS PAGE TO A FRIEND

VAT1

vesicle amine transport 1

Synonyms: VATI
UniProtKB ID: Q99536, A8K345, Q13035, Q5BKZ7, Q96A39, Q9BUT8
Gene ID:
Human(10493) Summary: Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. The protein encoded by this gene is an abundant integral membrane protein of cholinergic synaptic vesicles and is thought to be involved in vesicular transport. It belongs to the quinone oxidoreductase subfamily of zinc-containing alcohol dehydrogenase proteins. [provided by RefSeq, Jul 2008]
Mouse(26949) vesicle amine transport protein 1 homolog (T californica)
Rat(287721) vesicle amine transport protein 1 homolog (T californica)
cow(510698) vesicle amine transport protein 1 homolog (T. californica)
sheep(101113608) vesicle amine transport protein 1 homolog (T. californica)
naked mole-rat(101721305) vesicle amine transport protein 1 homolog (T. californica)
domestic guinea pig(100722067) vesicle amine transport protein 1 homolog (T. californica)
Thale Cress(831490) acetolactate synthase small subunit 1
domestic cat(101081683) vesicle amine transport protein 1 homolog (T. californica)
Horse(100065682) vesicle amine transport protein 1 homolog (T. californica)
dog(490953) vesicle amine transport protein 1 homolog (T. californica)
chicken(420009) vesicle amine transport protein 1 homolog (T. californica)
Zebrafish(368752) vesicle amine transport protein 1 homolog (T californica)
163 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006373 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012037 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012037 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012037 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006373 Rosetta Predictions human pricing
NM_001033683 Rosetta Predictions rat pricing
NM_012037 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341431 predicted 1334
2 SASI_Hs02_00341432 predicted 659
3 SASI_Hs01_00019932 predicted 822
4 SASI_Hs01_00019935 predicted 938
5 SASI_Hs01_00019936 predicted 1466
6 SASI_Hs01_00019937 predicted 1720
7 SASI_Hs01_00019938 predicted 885
8 SASI_Hs01_00019939 predicted 642
9 SASI_Hs01_00019940 predicted 819
10 SASI_Hs01_00019941 predicted 1348
11 SASI_Hs01_00019933 predicted 1558
12 SASI_Hs01_00019934 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033683 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118846 predicted 553
2 SASI_Rn02_00203695 predicted 303
3 SASI_Rn01_00118847 predicted 574
4 SASI_Rn01_00118848 predicted 1125
5 SASI_Rn01_00118849 predicted 1058
6 SASI_Rn01_00118850 predicted 450
7 SASI_Rn02_00203696 predicted 718
8 SASI_Rn01_00118851 predicted 1306
9 SASI_Rn01_00118853 predicted 777
10 SASI_Rn01_00118854 predicted 890
11 SASI_Rn01_00118852 predicted 218
12 SASI_Rn01_00118855 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052565 predicted 625
2 SASI_Mm01_00052566 predicted 363
3 SASI_Mm02_00322004 predicted 1633
4 SASI_Mm01_00052567 predicted 500
5 SASI_Mm01_00052568 predicted 937
6 SASI_Mm01_00052569 predicted 826
7 SASI_Mm01_00052571 predicted 1364
8 SASI_Mm01_00052572 predicted 1153
9 SASI_Mm01_00052573 predicted 667
10 SASI_Mm01_00052574 predicted 815
11 SASI_Mm01_00052570 predicted 1709
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006373
VALIDATED
VAT1 MISSION shRNA Bacterial Glycerol Stock
vesicle amine transport 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006373.2-558s1c1
Sequence:CCGGGCCTTGCTCGTCAATTACATTCTCGAGAATGTAATTGACGAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006373.2-566s1c1
Sequence:CCGGCGTCAATTACATTACAGCCTACTCGAGTAGGCTGTAATGTAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006373.2-1166s1c1
Sequence:CCGGCATGAAACAGATGCAGGAGAACTCGAGTTCTCCTGCATCTGTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006373.2-896s1c1
Sequence:CCGGCAAAGTCGTCACCTATGGAATCTCGAGATTCCATAGGTGACGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006373.2-770s1c1
Sequence:CCGGCGACTATCACACGACTGACTACTCGAGTAGTCAGTCGTGTGATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006373.3-834s21c1
Sequence:CCGGCGACTATCACACGACTGACTACTCGAGTAGTCAGTCGTGTGATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006373.3-1230s21c1
Sequence:CCGGCATGAAACAGATGCAGGAGAACTCGAGTTCTCCTGCATCTGTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006373.3-622s21c1
Sequence:CCGGGCCTTGCTCGTCAATTACATTCTCGAGAATGTAATTGACGAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006373.3-960s21c1
Sequence:CCGGCAAAGTCGTCACCTATGGAATCTCGAGATTCCATAGGTGACGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006373
VALIDATED
VAT1 MISSION shRNA shRNA Plasmid DNA
vesicle amine transport 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006373.2-558s1c1
Sequence:CCGGGCCTTGCTCGTCAATTACATTCTCGAGAATGTAATTGACGAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006373.2-566s1c1
Sequence:CCGGCGTCAATTACATTACAGCCTACTCGAGTAGGCTGTAATGTAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006373.2-1166s1c1
Sequence:CCGGCATGAAACAGATGCAGGAGAACTCGAGTTCTCCTGCATCTGTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006373.2-896s1c1
Sequence:CCGGCAAAGTCGTCACCTATGGAATCTCGAGATTCCATAGGTGACGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006373.2-770s1c1
Sequence:CCGGCGACTATCACACGACTGACTACTCGAGTAGTCAGTCGTGTGATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006373.3-834s21c1
Sequence:CCGGCGACTATCACACGACTGACTACTCGAGTAGTCAGTCGTGTGATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006373.3-1230s21c1
Sequence:CCGGCATGAAACAGATGCAGGAGAACTCGAGTTCTCCTGCATCTGTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006373.3-622s21c1
Sequence:CCGGGCCTTGCTCGTCAATTACATTCTCGAGAATGTAATTGACGAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006373.3-960s21c1
Sequence:CCGGCAAAGTCGTCACCTATGGAATCTCGAGATTCCATAGGTGACGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006373
VALIDATED
VAT1 MISSION shRNA Lentiviral Transduction Particles
vesicle amine transport 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006373.2-558s1c1
Sequence:CCGGGCCTTGCTCGTCAATTACATTCTCGAGAATGTAATTGACGAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006373.2-566s1c1
Sequence:CCGGCGTCAATTACATTACAGCCTACTCGAGTAGGCTGTAATGTAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006373.2-1166s1c1
Sequence:CCGGCATGAAACAGATGCAGGAGAACTCGAGTTCTCCTGCATCTGTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006373.2-896s1c1
Sequence:CCGGCAAAGTCGTCACCTATGGAATCTCGAGATTCCATAGGTGACGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006373.2-770s1c1
Sequence:CCGGCGACTATCACACGACTGACTACTCGAGTAGTCAGTCGTGTGATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006373.3-834s21c1
Sequence:CCGGCGACTATCACACGACTGACTACTCGAGTAGTCAGTCGTGTGATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006373.3-1230s21c1
Sequence:CCGGCATGAAACAGATGCAGGAGAACTCGAGTTCTCCTGCATCTGTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006373.3-622s21c1
Sequence:CCGGGCCTTGCTCGTCAATTACATTCTCGAGAATGTAATTGACGAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006373.3-960s21c1
Sequence:CCGGCAAAGTCGTCACCTATGGAATCTCGAGATTCCATAGGTGACGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012037
VALIDATED
VAT1 MISSION shRNA Bacterial Glycerol Stock
vesicle amine transport 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012037.1-2341s1c1
Sequence:CCGGGCACATTTCTTTCCTTTGCTACTCGAGTAGCAAAGGAAAGAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012037.1-1105s1c1
Sequence:CCGGGAGAGGTGGAACTCGTCAATACTCGAGTATTGACGAGTTCCACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012037.1-620s1c1
Sequence:CCGGCAATTATATCACCGCCTACATCTCGAGATGTAGGCGGTGATATAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012037.1-674s1c1
Sequence:CCGGCCATAGCGTCTTGGTACACATCTCGAGATGTGTACCAAGACGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012037.1-940s1c1
Sequence:CCGGCCATGGGCAAAGTTGTCACTTCTCGAGAAGTGACAACTTTGCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012037.2-1103s21c1
Sequence:CCGGGAGAGGTGGAACTCGTCAATACTCGAGTATTGACGAGTTCCACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012037.2-2339s21c1
Sequence:CCGGGCACATTTCTTTCCTTTGCTACTCGAGTAGCAAAGGAAAGAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012037.2-672s21c1
Sequence:CCGGCCATAGCGTCTTGGTACACATCTCGAGATGTGTACCAAGACGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012037.2-938s21c1
Sequence:CCGGCCATGGGCAAAGTTGTCACTTCTCGAGAAGTGACAACTTTGCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012037
VALIDATED
VAT1 MISSION shRNA shRNA Plasmid DNA
vesicle amine transport 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012037.1-2341s1c1
Sequence:CCGGGCACATTTCTTTCCTTTGCTACTCGAGTAGCAAAGGAAAGAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012037.1-1105s1c1
Sequence:CCGGGAGAGGTGGAACTCGTCAATACTCGAGTATTGACGAGTTCCACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012037.1-620s1c1
Sequence:CCGGCAATTATATCACCGCCTACATCTCGAGATGTAGGCGGTGATATAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012037.1-674s1c1
Sequence:CCGGCCATAGCGTCTTGGTACACATCTCGAGATGTGTACCAAGACGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012037.1-940s1c1
Sequence:CCGGCCATGGGCAAAGTTGTCACTTCTCGAGAAGTGACAACTTTGCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012037.2-1103s21c1
Sequence:CCGGGAGAGGTGGAACTCGTCAATACTCGAGTATTGACGAGTTCCACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012037.2-2339s21c1
Sequence:CCGGGCACATTTCTTTCCTTTGCTACTCGAGTAGCAAAGGAAAGAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012037.2-672s21c1
Sequence:CCGGCCATAGCGTCTTGGTACACATCTCGAGATGTGTACCAAGACGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012037.2-938s21c1
Sequence:CCGGCCATGGGCAAAGTTGTCACTTCTCGAGAAGTGACAACTTTGCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012037
VALIDATED
VAT1 MISSION shRNA Lentiviral Transduction Particles
vesicle amine transport 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012037.1-2341s1c1
Sequence:CCGGGCACATTTCTTTCCTTTGCTACTCGAGTAGCAAAGGAAAGAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012037.1-1105s1c1
Sequence:CCGGGAGAGGTGGAACTCGTCAATACTCGAGTATTGACGAGTTCCACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012037.1-620s1c1
Sequence:CCGGCAATTATATCACCGCCTACATCTCGAGATGTAGGCGGTGATATAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012037.1-674s1c1
Sequence:CCGGCCATAGCGTCTTGGTACACATCTCGAGATGTGTACCAAGACGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012037.1-940s1c1
Sequence:CCGGCCATGGGCAAAGTTGTCACTTCTCGAGAAGTGACAACTTTGCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012037.2-1103s21c1
Sequence:CCGGGAGAGGTGGAACTCGTCAATACTCGAGTATTGACGAGTTCCACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012037.2-2339s21c1
Sequence:CCGGGCACATTTCTTTCCTTTGCTACTCGAGTAGCAAAGGAAAGAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012037.2-672s21c1
Sequence:CCGGCCATAGCGTCTTGGTACACATCTCGAGATGTGTACCAAGACGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012037.2-938s21c1
Sequence:CCGGCCATGGGCAAAGTTGTCACTTCTCGAGAAGTGACAACTTTGCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks