EMAIL THIS PAGE TO A FRIEND

VAT1L

vesicle amine transport 1-like

UniProtKB ID: Q9HCJ6, Q8IYW8
Gene ID:
Mouse(270097) vesicle amine transport protein 1 homolog-like (T. californica)
Rat(361414) vesicle amine transport protein 1 homolog (T. californica)-like
Zebrafish(100136841) vesicle amine transport protein 1 homolog (T. californica)-like
Horse(100069355) vesicle amine transport protein 1 homolog (T. californica)-like
domestic cat(101099094) vesicle amine transport protein 1 homolog (T. californica)-like
dog(610152) vesicle amine transport protein 1 homolog (T. californica)-like
chicken(430410) vesicle amine transport protein 1 homolog (T. californica)-like
domestic guinea pig(100725802) vesicle amine transport protein 1 homolog (T. californica)-like
naked mole-rat(101699654) vesicle amine transport protein 1 homolog (T. californica)-like
cow(618809) vesicle amine transport protein 1 homolog (T. californica)-like
sheep(101119925) vesicle amine transport protein 1 homolog (T. californica)-like
147 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0110 AQUA Peptide AVVLAGFGGLN[K] cow, human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020927 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173016 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173016 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173016 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020927 Rosetta Predictions human pricing
XR_006986 Rosetta Predictions rat pricing
XR_009198 Rosetta Predictions rat pricing
NM_173016 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354315 predicted 721
2 SASI_Hs01_00102068 predicted 1546
3 SASI_Hs01_00102069 predicted 596
4 SASI_Hs01_00102070 predicted 316
5 SASI_Hs01_00102072 predicted 1193
6 SASI_Hs01_00102073 predicted 1201
7 SASI_Hs01_00102074 predicted 1628
8 SASI_Hs01_00102075 predicted 398
9 SASI_Hs01_00102076 predicted 1591
10 SASI_Hs02_00354316 predicted 1631
11 SASI_Hs01_00102067 predicted 1541
12 SASI_Hs01_00102071 predicted 1495
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00413375 predicted 646
2 SASI_Rn02_00413376 predicted 526
3 SASI_Rn02_00413377 predicted 262
4 SASI_Rn02_00413378 predicted 589
5 SASI_Rn02_00413379 predicted 443
6 SASI_Rn02_00413380 predicted 595
7 SASI_Rn02_00413381 predicted 423
8 SASI_Rn02_00413382 predicted 513
9 SASI_Rn02_00413383 predicted 661
10 SASI_Rn02_00413384 predicted 529
11 SASI_Rn01_00159526 predicted 1637
12 SASI_Rn01_00159527 predicted 1656
13 SASI_Rn01_00159528 predicted 1472
14 SASI_Rn01_00159529 predicted 1625
15 SASI_Rn01_00159530 predicted 1381
16 SASI_Rn01_00159531 predicted 1316
17 SASI_Rn01_00159532 predicted 1338
18 SASI_Rn01_00159533 predicted 1326
19 SASI_Rn01_00159534 predicted 1610
20 SASI_Rn01_00159535 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00419052 predicted 1015
2 SASI_Rn02_00419053 predicted 1613
3 SASI_Rn02_00419054 predicted 1592
4 SASI_Rn02_00419055 predicted 1410
5 SASI_Rn02_00419056 predicted 1560
6 SASI_Rn02_00419057 predicted 1250
7 SASI_Rn02_00419058 predicted 1273
8 SASI_Rn02_00419059 predicted 1257
9 SASI_Rn02_00419060 predicted 971
10 SASI_Rn02_00419061 predicted 1545
11 SASI_Rn01_00187220 predicted 405
12 SASI_Rn01_00187221 predicted 314
13 SASI_Rn01_00187222 predicted 209
14 SASI_Rn01_00187223 predicted 382
15 SASI_Rn01_00187224 predicted 312
16 SASI_Rn01_00187225 predicted 392
17 SASI_Rn01_00187226 predicted 315
18 SASI_Rn01_00187227 predicted 387
19 SASI_Rn01_00187228 predicted 371
20 SASI_Rn01_00187229 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173016 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086261 predicted 441
2 SASI_Mm01_00086262 predicted 283
3 SASI_Mm01_00086263 predicted 762
4 SASI_Mm01_00086264 predicted 379
5 SASI_Mm01_00086265 predicted 564
6 SASI_Mm01_00086266 predicted 1177
7 SASI_Mm01_00086267 predicted 1008
8 SASI_Mm01_00086268 predicted 1194
9 SASI_Mm01_00086269 predicted 1399
10 SASI_Mm02_00345078 predicted 704
11 SASI_Mm01_00086270 predicted 906
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020927
VALIDATED
VAT1L MISSION shRNA Bacterial Glycerol Stock
vesicle amine transport 1-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020927.1-1207s21c1
Sequence:CCGGAGGGAACATTGGCAAGTTAATCTCGAGATTAACTTGCCAATGTTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020927.1-464s21c1
Sequence:CCGGGGAGACCGTGTCATGGCATTTCTCGAGAAATGCCATGACACGGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020927.1-354s21c1
Sequence:CCGGTGGTGCGACAAGGGAATATTGCTCGAGCAATATTCCCTTGTCGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020927.1-797s21c1
Sequence:CCGGGACTACGTGCAAGAAGTTAAACTCGAGTTTAACTTCTTGCACGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020927.1-922s21c1
Sequence:CCGGTGGCTCATCCAACATGGTAACCTCGAGGTTACCATGTTGGATGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020927.1-2099s1c1
Sequence:CCGGGCTCCATATCTGTTTCAATTTCTCGAGAAATTGAAACAGATATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020927.1-318s1c1
Sequence:CCGGGCGTCAAAGCCTGTGGATTAACTCGAGTTAATCCACAGGCTTTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020927.1-599s1c1
Sequence:CCGGGCCTATGTGATGCTGTTTGAACTCGAGTTCAAACAGCATCACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020927.1-326s1c1
Sequence:CCGGGCCTGTGGATTAAACTTCATTCTCGAGAATGAAGTTTAATCCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020927.1-3176s1c1
Sequence:CCGGCCTAGTAAGTTGGGTAGAAATCTCGAGATTTCTACCCAACTTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020927
VALIDATED
VAT1L MISSION shRNA shRNA Plasmid DNA
vesicle amine transport 1-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020927.1-1207s21c1
Sequence:CCGGAGGGAACATTGGCAAGTTAATCTCGAGATTAACTTGCCAATGTTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020927.1-464s21c1
Sequence:CCGGGGAGACCGTGTCATGGCATTTCTCGAGAAATGCCATGACACGGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020927.1-354s21c1
Sequence:CCGGTGGTGCGACAAGGGAATATTGCTCGAGCAATATTCCCTTGTCGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020927.1-797s21c1
Sequence:CCGGGACTACGTGCAAGAAGTTAAACTCGAGTTTAACTTCTTGCACGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020927.1-922s21c1
Sequence:CCGGTGGCTCATCCAACATGGTAACCTCGAGGTTACCATGTTGGATGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020927.1-2099s1c1
Sequence:CCGGGCTCCATATCTGTTTCAATTTCTCGAGAAATTGAAACAGATATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020927.1-318s1c1
Sequence:CCGGGCGTCAAAGCCTGTGGATTAACTCGAGTTAATCCACAGGCTTTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020927.1-599s1c1
Sequence:CCGGGCCTATGTGATGCTGTTTGAACTCGAGTTCAAACAGCATCACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020927.1-326s1c1
Sequence:CCGGGCCTGTGGATTAAACTTCATTCTCGAGAATGAAGTTTAATCCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020927.1-3176s1c1
Sequence:CCGGCCTAGTAAGTTGGGTAGAAATCTCGAGATTTCTACCCAACTTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020927
VALIDATED
VAT1L MISSION shRNA Lentiviral Transduction Particles
vesicle amine transport 1-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020927.1-1207s21c1
Sequence:CCGGAGGGAACATTGGCAAGTTAATCTCGAGATTAACTTGCCAATGTTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020927.1-464s21c1
Sequence:CCGGGGAGACCGTGTCATGGCATTTCTCGAGAAATGCCATGACACGGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020927.1-354s21c1
Sequence:CCGGTGGTGCGACAAGGGAATATTGCTCGAGCAATATTCCCTTGTCGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020927.1-797s21c1
Sequence:CCGGGACTACGTGCAAGAAGTTAAACTCGAGTTTAACTTCTTGCACGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020927.1-922s21c1
Sequence:CCGGTGGCTCATCCAACATGGTAACCTCGAGGTTACCATGTTGGATGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020927.1-2099s1c1
Sequence:CCGGGCTCCATATCTGTTTCAATTTCTCGAGAAATTGAAACAGATATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020927.1-318s1c1
Sequence:CCGGGCGTCAAAGCCTGTGGATTAACTCGAGTTAATCCACAGGCTTTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020927.1-599s1c1
Sequence:CCGGGCCTATGTGATGCTGTTTGAACTCGAGTTCAAACAGCATCACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020927.1-326s1c1
Sequence:CCGGGCCTGTGGATTAAACTTCATTCTCGAGAATGAAGTTTAATCCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020927.1-3176s1c1
Sequence:CCGGCCTAGTAAGTTGGGTAGAAATCTCGAGATTTCTACCCAACTTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173016
VAT1L MISSION shRNA Bacterial Glycerol Stock
vesicle amine transport 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173016.2-2189s1c1
Sequence:CCGGGCTCCCTTGAAGACAGTATTTCTCGAGAAATACTGTCTTCAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173016.2-707s1c1
Sequence:CCGGGCCTCTACTTTCAAGCATGAACTCGAGTTCATGCTTGAAAGTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173016.2-299s1c1
Sequence:CCGGGCCTGTGGCTTAAACTTCATTCTCGAGAATGAAGTTTAAGCCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173016.2-555s1c1
Sequence:CCGGCCATGAATTTCGTCACCGCATCTCGAGATGCGGTGACGAAATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173016.2-918s1c1
Sequence:CCGGGAGAGACCAAGAGTTTCTTTACTCGAGTAAAGAAACTCTTGGTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173016
VAT1L MISSION shRNA shRNA Plasmid DNA
vesicle amine transport 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173016.2-2189s1c1
Sequence:CCGGGCTCCCTTGAAGACAGTATTTCTCGAGAAATACTGTCTTCAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173016.2-707s1c1
Sequence:CCGGGCCTCTACTTTCAAGCATGAACTCGAGTTCATGCTTGAAAGTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173016.2-299s1c1
Sequence:CCGGGCCTGTGGCTTAAACTTCATTCTCGAGAATGAAGTTTAAGCCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173016.2-555s1c1
Sequence:CCGGCCATGAATTTCGTCACCGCATCTCGAGATGCGGTGACGAAATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173016.2-918s1c1
Sequence:CCGGGAGAGACCAAGAGTTTCTTTACTCGAGTAAAGAAACTCTTGGTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173016
VAT1L MISSION shRNA Lentiviral Transduction Particles
vesicle amine transport 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173016.2-2189s1c1
Sequence:CCGGGCTCCCTTGAAGACAGTATTTCTCGAGAAATACTGTCTTCAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173016.2-707s1c1
Sequence:CCGGGCCTCTACTTTCAAGCATGAACTCGAGTTCATGCTTGAAAGTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173016.2-299s1c1
Sequence:CCGGGCCTGTGGCTTAAACTTCATTCTCGAGAATGAAGTTTAAGCCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173016.2-555s1c1
Sequence:CCGGCCATGAATTTCGTCACCGCATCTCGAGATGCGGTGACGAAATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173016.2-918s1c1
Sequence:CCGGGAGAGACCAAGAGTTTCTTTACTCGAGTAAAGAAACTCTTGGTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks